| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCAGUGGUUUCUUGGUGACACUGGAUAGAACAGCUCAAGCCUUGCCA… | 1492 nt | 0.5536 |
The protein encoded by this gene is a preprohormone which is cleaved to form two biologically active peptides, adrenomedullin and proadrenomedullin N-terminal 20 peptide. Adrenomedullin is a 52 aa peptide with several functions, including vasodilation, regulation of hormone secretion, promotion of angiogenesis, and antimicrobial activity. The antimicrobial activity is antibacterial, as the peptide has been shown to kill E. coli and S. aureus at low concentration. [provided by RefSeq, Aug 2014]
A study in cynomolgus macaques demonstrated that acute methamphetamine administration significantly downregulated hippocampal ADM mRNA expression, while chronic administration significantly upregulated it compared to controls [Choi et al. DOI:10.1016/j.taap.2018.05.031].