| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCUGAUCUCUGACUGCAGCUCCUACUGUUGGACACACCUGGCCGGUG… | 2459 nt | 0.5254 |
The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. Knockout studies in mice suggested that this protein inhibits embryonic oligodendrocyte precursor migration in developing spinal cord. This gene, IL8RB, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the CXCR1 (CXCR1) is a potential diagnostic and severity biomarker for mustard gas chemical injury, as its expression in PBMCs exhibited a marked decrease in the Severe group compared to other groups, with machine learning models achieving up to 94.38% accuracy in severity discrimination [Arabfard et al. DOI:10.1016/j.intimp.2025.114090]. In mice, a separate investigation of brain injury noted that human neutrophil-like monocytes are classified as CXCR1+CD14+CD16−, though this specific marker was not experimentally studied in the murine model [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8].