Basic Information

Symbol
CXCR1
RNA class
mRNA
Alias
C-X-C Motif Chemokine Receptor 1 CDw128a CMKAR1 CKR-1 CD181 IL8RA High Affinity Interleukin-8 Receptor A Chemokine (C-X-C Motif) Receptor 1 C-X-C Chemokine Receptor Type 1 Interleukin 8 Receptor, Alpha IL-8 Receptor Type 1 IL-8R A CXC-R1 CXCR-1 Interleukin-8 Receptor Type 1 Interleukin-8 Receptor Type A CD181 Antigen C-C-CKR-1 IL8RBA CD128 IL8R1 C-C
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000634.3
Sequence length
2459.0 nt
GC content
0.5254

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-845.70 kcal/mol
Thermodynamic ensemble
Free energy: -894.40 kcal/mol
Frequency: 0.0000
Diversity: 757.79
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((.(((((.......(((((((....(.(((((..(((((((((((((((((....(((((...((((..(((..........(((..(((........)))..))).)))..)))))))))((((((((....((((((((((((((...(((..(((....))).))).....)))))))))....)))))....(((((....))))).))))))))....((((((((((..(((..(((((.....((((...)))).((((((((.(((.((((.....((((((((((((((....((((......((........))...))))..)))))))))...((....(((.((((((((((....))))(((((...)))))..((((((((..(((((((((....)))))..((((((((.......((((((((.........((((((((.....((.(((.(((((...))).)).))).))......))))))))....((((((.(((.(((((((.((........)).)))).))).))).)))...))).((.((((((.............))))))))....))))))))......)))).))))...))))....))))).))).........))))))..)))....)).(((((((((((((((((((((..((.((...((.....))...)).))..)))))).)))))))))....)))))).)))))..))))..)))..)))).))))))))))))..))).)))))))))))))))).)))..((.((.((....)))).))((((((((.....((.(((((((((.(.((........)).)..))))))))))).....))))))))..))))).))))).))))))))..((((((..(((((((((((.((((((((..(.(((..(((......(((((.......((((((..................(((......)))..........((((.((((((((...((((..(((((....))))).))))....)))))))).))))(((....)))((((((((((((((..(((((..(((.....(((.((((....(((((...........(((((......)))))))))).))))))).......)))...)))))..))))).)).)))))))..(((((((((.(((((.....((((.....(((((((.....(((((((((.(......((((.(((((.((((..((......))....(((((.((((.(((.(((((...((....))...))))).))).)))).)))))..)))))))))...)))).......).)))))))))............((((((.......))))))(((((((...............)))))))......(((((.((((((((.(.(.((((((((((.....))))))).)))((((...((((((((.((((...((((((((((((((((..(((((((((...)))))))))....)))).))))....))))))))((((((.....)))))).(((((((((((((((((((((...........))))))))))))...)))))..))))(((....)))((((((.(((((((......)).)))))....((((((((.(.(((((((..(((.....((((((((...)))))))).((((.(((((...............(((.....)))....(((...(((.(((((........((((((((.(.(((((.......((.(((((((((((.....((((((((......(((((((((((.((((..(((.((((.((......((((((((((....(((((.(((((((((((.(((........))).)).......)))))).))).))))).......))))))).)))...)).))))))))))).))).))))))))....)))))).))...(((((.....)))))..(((((....)).))))))))).))))).))))))))))))))))........))))).))))))))))).))))......))).))))))).))))).)))).(((.((((......)))).)))))))))....)))).))))))))..)))).).).))))))))))))).(((((((.(((((((..((((..(((..(((....)))..)))..)))).)))....))))))))))).)))))))))))..))))))))).))))))))))).......))))).......)))..))))..)))))))).))))).........))).)))...))))))...((((.........))))..........))))).)).......
Thermodynamic Ensemble Prediction
.{{.(((({...{{({(((((((,{.,,,,{(({,,{{{{,{{{,||||((((((((..{.(({....})).)..)))))))).((,{{((({,......,,|{{{(|,{,...|}||||}}}||{{{{||....,,|||{||||||||,.,|,(||{{({,.{|||{{||{...,}}|||||}|....{({{...}}||{{{,,,.}))))}))))}))}|,,,.{{{{{{({(,.{{{((((({(({((((((,...,})).|||{{({{{{}},,,,.....)))))((((((((((.{,,(((({.{,,{,......|,|},...,)))..,))))))))},{{{{{(((,,(((((..((((....))))(((({...,||||{({(((((({...,||||{||,,,,)}))}.|||||||,,,,,..,,||,({{{{....}}}}|.{||{|{|{{{{,{{{|||||||,|},||||||||||,||,..,,||||}},,},,}}.||{{{{.(((.{((((((.{(........)).))))||)}.))).}),..})))|((,((((((.,...........)))))}}}..........{{({,.{(((({{{.,{,{.(((((............)))))..,,}))).))))))))}.},.,}})}}...,(((.((((.((((((((....((,{(((((.....(((........)))(({{.....}}.)).(((((.(,.{(((,,(({{{{(.{....,,{,....{((((.{,{{||||.,,||||..|,,||}}|,}||}|......},},,.((((((((.....((.(((((((((.{.((........)).,..))))))))))).....)))))))).)))))))))))).))))))))))))))))))))}.)))).)))||,|{{,|||}|}||||}{{|{,,(,,({{{{{|{{{,,,||||.|,..,||||..|||||.||||||...(((({........((((.(((((,,,...||}|},|||{{....))))).))))}}}})))))),,.,}||(((....)))||((((((((((((..(((((..{((....,{,{,(({{....(((((...........(((({,....,}))))))))).))}}))),,,,...}}}...,))))..))))).)),}))))},.,))))}.}),}))))}},,..,)))).,|||||{||{||...{|{{{||||,|,,},|.|||{,|||||.{{||,|||......}}....{{{{{,((||,||{.{((((...{(.,,,}|,.,})}}}.|}}.})}}.|||}}..}}}}}}}}}...}}}}.,,|,,.}.}}}}}}))),,,,........((((((.......))))))(((((((....,.....,}...))))))).,.,..(((((.((((((((.{.,,{{{(((((((..,,,||||}}}},||{{{{.,.{{||||||,{{({,..{{((((((((({((({,.(((((((({...}))))))))...,)))).})))....))))))))((((((.....))))))|{((((((((((((((((((((.{{....})..))))))))))))...})))},.})))|((....)))(((({(.((((({(......)}.))))).,..((((((((.(,(((((((..(((.....((((((((...)))))))}.{(((.(((({,,..............{{.....,,}||.{{{{...(({.(((((........((((((({,(.(((((,......{(.(((((((((((....,{{((((((......(((((((((((.((((..(((.((((.({...,..((((((((((....(((((.(((((((((((.(({........})).}},......}))))),))}.))))).......))))))).)))..,)).))))))))))).))),,))))))),...)))))).})...(((((.....})})}..{{{,{|...,},)}})))))}}))))).))))))))))))))))........))))).}))))}))))).)))}......))).))))))).))))),)))),{{{.((((......)))),)))))}}))....)))}.}}))))))..}))),}.}.))))))))))))).(((((((.((((,,.,,((((,,(((..(((....)))..))),.))),.,})....))))))))))).}},,},}}},,,.,}}}}}})},)))})))))}}........,.((({{{{({......))))))))}|||,.,,|||{,{,,,,,||||..|||,||}}}}}},.((((.........))))......,,..)))}),)),,,,,..

Transcripts

ID Sequence Length GC content
ACUCUGAUCUCUGACUGCAGCUCCUACUGUUGGACACACCUGGCCGGUG… 2459 nt 0.5254
Summary

The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. Knockout studies in mice suggested that this protein inhibits embryonic oligodendrocyte precursor migration in developing spinal cord. This gene, IL8RB, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the CXCR1 (CXCR1) is a potential diagnostic and severity biomarker for mustard gas chemical injury, as its expression in PBMCs exhibited a marked decrease in the Severe group compared to other groups, with machine learning models achieving up to 94.38% accuracy in severity discrimination [Arabfard et al. DOI:10.1016/j.intimp.2025.114090]. In mice, a separate investigation of brain injury noted that human neutrophil-like monocytes are classified as CXCR1+CD14+CD16−, though this specific marker was not experimentally studied in the murine model [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8].