Basic Information

Symbol
CXCR5
RNA class
mRNA
Alias
C-X-C Motif Chemokine Receptor 5 MDR15 CD185 BLR1 Burkitt Lymphoma Receptor 1, GTP Binding Protein (Chemokine (C-X-C Motif) Receptor 5) Burkitt Lymphoma Receptor 1, GTP-Binding Protein Chemokine (C-X-C Motif) Receptor 5 C-X-C Chemokine Receptor Type 5 Monocyte-Derived Receptor 15 CXC-R5 CXCR-5 MDR-15 Burkitt Lymphoma Receptor 1 CD185 Antigen
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis

MANE select

Transcript ID
NM_001716.5
Sequence length
4293.0 nt
GC content
0.5837

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1804.20 kcal/mol
Thermodynamic ensemble
Free energy: -1878.25 kcal/mol
Frequency: 0.0000
Diversity: 833.96
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
............(((.(((((((((((((((.(((((..(((((((((((((...((.(((.((....((((((..((.((((.((...)).)))).))..))))))....((..((...))..))..........((((.....))))........(((((((((((((.(((.(((((((((((((((((......))))))))(((.((((((.......((((((...(((((((..((((((........))))))((((((((.(........).))))))))...(((.(((....((.(((..(((((((.(.((((..((((((.((((((((.......))))((((((((((((((((((.(((((..((((((((((...(((((((((((((...))))).((((........)))).((((....(((........)))...)))).((((((((((((((.(((.((.(((((.((((((((....((((((...(((((((((((....((((..(((..((((((((((((((....(((.((.(((...))).)).)))((((((((((.(((.((((((.(((((.((((.(((....((.(((((.(((............((((((((..(((.((((((((((.....((((((.(((........))).))))))((((((((..(((((((((..((((((((...)))))))).(((((((((((.((..(((.((...((((((..((.((((((..((.(((((((((((.((.(((.(((((.((((......(((((((((.(((....((((((.((((...........))))(((......))).....))))))....))).)))))))))..((((...))))(((.....)))))))..)))))..))).))((((.(((((......))))).).)))...))))))))))).))))).)))))...)))))))).)))..)).))))))))))).((((.(((((.((((......)).))))).)).))))((((((...))))))(((...((((((((((((.......)))))))))))).)))...((((((...))))))..((((((.((((..(((((((((((((((((..((((....(((((((((((((.....)))))).)))))))....))))((((((......))))))))))).))).))))).....))))...)))).).(((((((((.(((......((((((((((...(((((((((......(((.((.....(((((..(((((.(((..(((...(((((((((.((((((((((((.(.((...((((....((((.(((((....)))))))))......)))).))))))))))))(((.....))).........))).))))...............((((.....))))......))))).)))..))))))))((..((((((...((...............)).)))))).))((((((((((....(((((((((..((.(((.(....(((...)))..).))).))..)))....))))))...))))))))))(((((..((...((((...((((((.....((((......((((......)))).......))))......))))))))))))..)))))...((((...))))...)))))....)))))..))))).))))...)))))))))).(((.(((.......))).))).(.((((((((((.((.((...((((((((..(((.((((((.(((((.(((((((....)))))))..)))))..)).)))).))).((......))...........................(((((((((.....)))))))))..))))..))))(((.(((......)))...)))(((((......))))).)).)).)))))))))).))))..))))))))))))))..)))..))))))))))))))((((((....((((((((.((.(((......))))).)))))).))....)))))).......((((.(((....))).).))).....)))).))))))))).(((.((((...(((((((....)))..)))))))))))(((....)))....))))))))(((((.......)))))..(((((((..(((((((.((((((((.(((.((..(((((((...((((.......))))...))....)))))..)).)))..(.((......)).).)))))))).)))).))).(((((((.....))))))).(((((.....(((((((.(((......))))))))))..))))).)))))))((((.......))))(((((.(((...))).)))))....((((...))))........))).))))).))))))))).)))))...)))))).))).))))))))))((((((...((((((.(((((..((((((((((.((...(((....))).)))))))..........)))))..))))).))))))...).))))).....(((((((...))))))).((((.......))))............(((..(((....(((((((((((((.........)))))))..............((((....)))).(((.(((((((((((((..(((((......)))))..)))))))..)))))).)))...)))))))))))).)))))))))))..)))..)))))))....)))))))))))(((((((((((.((((..((((.....)))).......))))...))))))))))).))))))......))).)).)).).))))).)).)))..))))))))))))))))))))))....)))))))))).))))).))))))).((((.....)))))))))))))))((((.....))))............)))).)))))))))).)..)))))))..)))))))).))).(((((.((....))))))).))))))).((((..(((((((.......)))).)).)..))))...))))))((((..(((((((.(((((((((((((((.........))))))).....((((((((((((((((..(((((.(((((((...((........)).)))))))....)))))))))).))))))))((((((.......))))))))))))))))))))))))...)))))).)))).)))((((.(((((((((.......)))))))))))))(((((((..(...(((........)))...).....)))))))...((((.((...)))))).)))).))))).))))))))).)))))))....)).)))))...))))))))))).))))))))))...)))).)))))..(((((((...(((((((((.(((((((.(((((((.(.(((((((.((((.((((((((((.(((.((..(((((.(((((....((.......))((((((((.(((((((((..(.(((((((((((((....(((((((((..((((((....))))))..)).)).)))))..))))....))))))((((((((.(.(.....).)))))))))......(((((........)))))....))))..)))))))).).))))))))..)))))....)))))..))))).))))))).....(((..(((((...)))))...))).......((((((.(((.....)))))).)))((..((((.(((.((((...))))..))).)))).))((((((((((((((......))))).))...))).))))....))).))))..))))))).).)))...(((((.(((((.(((((((((.(((...))).)))))).)))))))).))))))))).)))...)))).))))))).))))))))).))))))....((((((((..(.......)..))))))))((((((..((((((((.((((.((((..(.((((....))))....)..)))))))).))))))))))))))(((((((..(((.(((...((((((((((.(((((....))))).)))))))))).))))))..))))))).......
Thermodynamic Ensemble Prediction
............{{,.(({((((((((((((.(((((..(((((((((((((...((.(((.((...,((((((..((.((((.((...)).)))).))..))))}}....{{,.||...||..},..........({((.....}}}}........(((((((((((((.(((.(((((((((((((((((......)))))))){((.(((({{.{{{...,,|||,,..(((((((,,(((({(,,.,,,,,}}||||{{{((((({({..{{...,.,)))))))}},(((.(((....((.(((..(((((((.{.((((..((((((.((((((((.......))))((((((((((((((((((.(((((..((((((((((..{(((((((((((({...})))},((({...,,,..||||.(((({...((,..........)}}}),,},({((((((((((({.{{(.((.(((((.((({{(((|,..{{(({{..,(({((((((((.{,.((((..(((,{((((((((((((((...,(((,((,{({...|||.}|,|}}((((((((((.(((.((((((.(((((.((({{(((....((.(((((.(((............((((((((..(((.((((((((((.....((((((.(((........))).)))))){(((((((.,((((({(((..((((((((..{|((((.{{.(((((((((((.((..(((.((...((((((..((.((({{(,,,(.(((((((((((.((.(((.(((((.((((......(((((((((.(((....((((((.((((...........)))){||,,,,..}}}.....)}}}}}....))).)))))))))..((((...)))){{{.....,,}))))..)))))..))).,,(((,,(((((......))))).).))).,,))))))))))),,)))}.)))))...)))))))).)))..)).)))))))))))..}}...)))).}}))))))))|{{{,|,,.,}.}))}((((((...)))))){({.{{((((((((((((.......))))))))))))}))),..((((((...))))))..((((((.((((.,(((((((((((((((((,.((((....(((((((((((((.....))))))}}))))))....))))((((((......))))))))))).))),,)))}....,))))...)))).,.(((((((((.(((.{....((((((((((...(((((((((......(((.((.{.{,(((((..(((({{(((..(((...(((((((((.((((((((((((.(.((...((((....((((.(((((....)))))))))......)))).))))))))))))(((.....))).........))).))))...............((((.....))))......))))).)))..))))))))((..((((((...,(...........,,..,,.)))))).))((((((((((..,.(((((((((..((.(((,.....{{,...,},..).))).))..)))....)))))).,.))))))))))(((((..((...((((...((((((.,{..((((......((((......)))).......))))..}.,.))))))))))}),.)))))...((({...})))...))))),.}.)))))..))))).))))...)))))))))){(((.(((.......))).)))}|.{(((((((((.((.(({{.((((((,((((((.(({,,({(((,,.{{,,,||.}}})))),))}})),))}},)}))||.||..,(......||......,}......,...,}}......(((((((((.....)))))))))...,|||..}},|||.(((......)))...}}}(((((......))))).)).)).))))))))))},)))..))))))))))))))..)))..)))))))))))))}((((((....((((((((,((.(((......)))})})))))).))....)))))).......((({.(((....))).).))).....))))}}}))))})).(({,((((...{(((((,...}))),.},,,)))))))(((....)))....)))))))){((((.......))}}},.(((((((..((((({(.((((((((.(((.((..((((({{({{((((.......)))}..|))....)))))..)).)))..{.((......)).}.)))))))).))||,|||,{{,,{||.....}))))},}||||,.....(((((({,(((......))))))))))..,))))})))))))||||..,,.{{{|||{{{((,{{{...))).)))))}.},((((...))))........))).))))).))))))))).)))))...)))))).))).))))))))))..{{{,.{{((((((.(((((..(((((({(((.{,.,,{{{....,}}.}}))))}},,,...,,})))))..))))).)))))).,,},}}}}}.....,((((({...})))))}.{(((.......)))),....,,,....(({..{{||...{((((((((((((.........)))))))..............((((....)))).(((.(((((((((((((..(((((......)))))..))))))}..)))))).)))...)))))))))))).)))))))))))..),)..)))))))..}})))))))))))(((((((((((.(((({.((((.....)))).}.....)))).})))))))))))).))))))....,.))).)).)).).))))).)).))),.}))))))))))))))))))))),}..)))))))))).))))).))))))){((((.....)))))))))))))))((((.....))))............)))).)))))))))).,..)))))))..)))))))).))).|||||,||,,,,))))))).))))))).((((..(((((((.......)))).}).)..))))...}}}}|(((((..(((((((.(((((((({((({{{......,,.}}})))}.....((((((((((((((((..(((({.(((((((,.,({.....,,.}),))}))))....)))))))))).))))))))((((((.......))))))))))))))))))))))))...)))))).)))).))}{((,{(((((((((.......)))))))))))))(((((((..{...(((........)))...}.,.,.))))))).,.((((.((...)))))).)))).))))).))))))))).))))))),},.)).)))))...))))))))))).))))))))))...)))).)))|||,(((((((...(((((((((.(((((((.(((((((.(.(((((((.((((.((((((((((.(((.((..(((((.,((((....{{.......))((((((((.(((((((((.{(.((,((((((((((.{..((((({,((,,((((((....))))))..)).)).))))),.))))....)))))){((({{((.{.,...,.|||}}}}||||......|||{{.},,,...|||||....)))),})))))))).).))))))))..}))))....)))))..))))).)))))))......,,..(((((...}))))...,,|{,,...,|||||,((((.....)))),|,|||((..((((.(((.((({...})))..))).)))).))|||||,|,,(((((......)}))).}}.,{|||.,,.),}}}))).))))..))))))).).)))...(((((.(((((((((((((((.(((...))).)))))).)))))))).)))))}))).)))...)))).))))))).))))))))).}}}}}}....((((((((..{.......)..))))))))((((({..((((((((.((((,((({..|.|||{,,,,||},....),,)))})))).))))))))})))))(((((((..(({.{({...((((((((({,(((((....))))).)))))))))}.}}})))..))))))).......

Transcripts

ID Sequence Length GC content
CUCUCAACAUAAGACAGUGACCAGUCUGGUGACUCACAGCCGGCACAGC… 4293 nt 0.5837
Summary

This gene encodes a multi-pass membrane protein that belongs to the CXC chemokine receptor family. It is expressed in mature B-cells and Burkitt's lymphoma. This cytokine receptor binds to B-lymphocyte chemoattractant (BLC), and is involved in B-cell migration into B-cell follicles of spleen and Peyer patches. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Forensic Context

A study in rats demonstrated that the CXCR5 mRNA was transiently upregulated at 2 hours after a 5 psi blast exposure and showed earlier, greater, and sustained upregulation after a 10–11 psi blast exposure, with a transient upregulation also observed at 24 hours after a 14–15 psi exposure, indicating its role in lymphocyte activation and migration pathways following blast-induced traumatic brain injury [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. A review of single-cell sequencing in mice and humans following myocardial infarction identified the CXCR5 as a marker highly expressed in heart-associated B-cell populations, where it is co-expressed with CCR7 and associated with activated B-cell states [Bian et al. DOI:10.3892/mmr.2025.13680].