Basic Information

Symbol
CXXC4
RNA class
mRNA
Alias
CXXC Finger Protein 4 IDAX Dvl-Binding Protein IDAX (Inhibition Of The Dvl And Axin Complex) Inhibition Of The Dvl And Axin Complex Protein CXXC-Type Zinc Finger Protein 4 CXXC Finger 4
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_025212.4
Sequence length
5569.0 nt
GC content
0.4164

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1585.77 kcal/mol
Thermodynamic ensemble
Free energy: -1693.40 kcal/mol
Frequency: 0.0000
Diversity: 1632.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((((((((((((((((.(((((((.....)))(((((((((((((....(((..................................)))..)))))))))))))...........)))).)))((((.((..........((((((.((((((..((...((((((.....................))))))..))..))))))..........(((((((((....(((((.......((.((((....((((...((.((((...........))))..)).))))...))))..)).......))))).....((....))...............(((((.(((.((..(((((((((....(((((((((((((((....(((((..(((((....))))).))))).............(((((((.(((((((....((((...((((.((((((((((((...((((.((((((((.....)))))))))))).((((((((((.((((....((.(((((((......((((((((.........((....((((((....))))))....)).......)))))))).....(..((.(((((......))))).))..)...(((.(((.........(((.((((((((((..(((((((((((((((.((((((((.(((.(((.(((.(((((((((..(((((....))))))))((((((((.(((((.(((((.((((....))))..))))).))))).)))))))).)))))).))).)))((((((.((((.(((.(((((.(((((((((((.((.((.((((((((((.....))))..)))))).)).)).))))))))))).)))))))).)).....))))))))))))))))))).)))))))))))))))(((((.......)).))).............(((...)))))))))).))).))).))).)))))))))).))...)))).)))).........)))))))))))).................))))))..)))).(((((((((...((((..(((....((.(((((((((((.((.(((((.....))))).....(((((.(((((......(((......))).....(((((..........)))))(((((((((....)))))..))))....)))))))).)).)).))))))).)))).))...)))..)))).....(((((...)))))..(((....)))...)))))))))......))))......))))))).(((((.(.......))))))...))))))).))))))))(((((..((((((....(((((.((.((.(((.....))))).)))))))....))))))..)))))....(((((((....(((((...((((((((((((((((.((((...........)))).))))))...........((((((((((..((((((.(((....))).)))......)))((((((...(((((....(((((((((.(...............).)))))))))...))))).))))))(((((((..((((..(((((((.........))))))).............((((.((((..............))))(((((((((((.(((((((.((((((((.((((.((((...(((((((((((.....................))))))))))))))).)))).)))).((((...)))).((((((((((((..(((((((((((..(((.......(((..(((....)))..)))........(((((.(((....)))))))).....))).))))))))))).............((((........))))))))))))))))....(((((((......))))))).(((((....)))))(((..((((((((((....((..((((.....))))..))(((((((.(((((((.((((((.......)))))).))))))).((((..(((...)))..)))))))).))).(((.(((((......))))))))...))))))))))..)))((((((.(((((....)))))..(((((.(((((((.....((((((((((.(..((((((....))))))..)((((((....((((...))))....))))))(((.((((((......)))))).)))(((.((((((.(((...(((((((((..((((...((((((.........))))))..))))...).))))).)))....))).)))))))))........)).))))))))...((((((......)))))).(((((((....((((((......))))))....)))))))...))))))))))))....((((((((...............))))))))((((((...))))))....(((......)))...((((.(((((((((((.......)))))))))))..))))..((((((((((.((((((...((.....))..))))))....))))))))))..((((((((((((((..(((((.(((((....))))))))))..........((((((.....))))))))))))))))....)))).)))))))))).))))))).)))))))))))...))))...))))))))))).(((((((..(((((((.((((((.........(((((.((((((..(((((.((.((.(((((..(((((.(((((((...((.((((.((..(((..((.(.((....)).).)).))).)).)))).)).......(((........))).((((........))))(((((.((((........((.(((.(.(((((((...(((........)))....))))))).)))).))(((((((.....(((((...(((((((((((................(((((......)))))))))))))))).)))))..((((((((..(((((.(((.......)))...)))))..)))))))).)))))))..)))))))))((((((......))))))..(((..(((((((......)))))))..))).))).).)))))))).....))))))).)).))))).)))))))))))......)))).)).))))))).)))))))..................(((((((....)))))))...)))))....))))).........))))))))))..)))))....)))))))..)).)))))....))))))))).)).....(((((....)))))..((((((...))))))((((......))))((.((.((((....)))).)).))))).))))).....))))))))).............((((.((...)).))))........))))))((((((((.....((((.((........)))))).......))))))))((((((....((.....))....))))))..)).))))(((((......))))).....((((((((.(((((......(((((((.....)))))))..((((((((((....((((..((((((.....((((((((((((...(((((.((..(((((((((((..((((((......)))))))))))((((((((((((.((.........))..((((((....))))))..((((((.......))))))......((((((((.....(((((((......((((.(((((((((((((((((((........(((......))).......)))))))))))))))((((.((((.....)))).))))..))))))))...))))))).))))))))((((((...((((((..((((((((.....))))))))..))))))...))))))(((((((((........))))..))))).(((((.((((((.....(((.......((((.((((...((........))...)))))))).......))).....)))))).)))))..(((((((((..((.(((((.(((((((((((....((....))....)))))....)))))).....))))))).....)))))))))...)))))))))))).........(.(((((((((((((((((.(((((..((((...............)))))))))))))))))))......))))))).)..(((((((((.................)))))))))(((((((........))))))).....))))))..)).)))))....))))))))))))...))))))))))(((((((....(((((...)))))......)))))))..(((((.((((((.((((.((........)).)))).))))))..........((((((((.....(((((((((..(((((........))))))))))..))))...........((......))))))))))....)))))...(((((.............)))))...(((((((.......)))))))..((((((((..((..(((......))).))..))))..))))))))))))))..((((...))))))))).))))))))..........)))))).)))))))..........((((..(((((((((((.((((....)))).))))))...)))))))))..((((.(((......))).))))............((((((((.......)))))))).(((((.....)))))........))))).....((((....)))).((((((((((...((((((((((.((((..(((((((((((((((((((((((.(((.....)))...(((.(((.(((((((..(((((.((.....)).).))))....))))))).))).)))....(((.(((.(((((....)))))..))))))((((......))))...))))))))))))))))))..))))).......(((((.((.......)).)))))........)))).)))).))))))..((....))...((((.....((((.(((((.(((((((((((((((((......((((((.((((.(((((.((((.........))))........(((((((((.......))))))))).))))).)))).)))))).(((....)))............(((((((((.......((((..((((..(((.......))))))).))))...)))))))))......................................))))).......))))))..)))))).))))).))))))))..))))))))))..........
Thermodynamic Ensemble Prediction
(({({,{({{{{(((((,.(((.(((((({.....}}}(((((((((((((....(((.....,............................)))..))))))))))))).....,,,))})))).))),.,,.,........{{,({({{{.((((((..((...((((((...,{,.........}}}...))))))..))..))))))....{,{..((((({|((({|{{(({,{,,{,{{.{{.({((....{{{,,,}}|,{,((,,,..,|||||||||,....||||{{.||||..||.......,}},,...,,((.,.|||....,,,........,,,,,.,.,.....,,,,,.,,,....{{,,...............,||||..||{||}}},))},}...,,|{{{{{{{,,,........,{{{{{.{{,((((((((((((.....(((((((((((...((({,((((((((.....)))))))))))).((((((((((.((((....((.(((((((....,.((((((((.........((.{{.((((((....)))))).)}.)).......)))))))).....,,,((.(((((......))))).)}..,...|{{{,{.,{{{{{{{{((...,(((((,((..(((((((((((((((.((((((((,({{...,}|,,.{((((((({..(((((....)))))}},((((((((.(((((.(((((.((((....))))..))))).))))).)))))))),)))))),)))})))|,|}||}|}}|}}||}|,,||,|||||,|||||}||}||,{||(({{(({...,,|}||||||||||{||.||.||,|||||,||.||,}},|{{{{.......,)))))),)),)))))}}),)),))))))))))||||{||,.,{,||.}}}.,,.,{,......,{(...|,}})))))),,.)})))}))),,}}))))))).))...)))).)))).........)))))))))))){,((((((.((((..(((({,...,{,,((((((((((((((,.....,,.....{{,(((((((((((.((.(((((.....))))).....(((((.(((((......{{(,,....,))}....(((((.,......}.)))))(((((({{(....})))}.,))))....)))))))).)).)).)))))))}}))).}}....)))))))))...,(((({...})))),...,})))),},..,,,}}||||,((.,({{.((((,,..})))}))}..)).)))|((((((((((....,.(((((((...((((((((((((((.(((((({{,..,.((.((.,(((((((.((....)).))))))).,.)).)),,....,))).))))))){((({,..,{||||{,..((((((.((((...........)))).))))))....,.((((....)))).(((((.((.((((((..,.{(((,...,..{((((((......(((((....(((((((({,(,...,,.....,,..),)))))))))...))))).))))))){((((,.,{{{((((((((((.........)))))))..}},,.}}...)))}),,,|,...............,||(((((((((((.{((((((.((((({...{(((,({((({(((((((({((({,{{......,,,....{{{,|||||||||,,|,,,,,|||...}},||{{|,|,|}||{((((((((({{.,(((((((((((.,({{.....,.{((..(((....})),.))}{,......{((((.,{{,,..|||||}}}.....))).))))))))))).,,,,,.,,..}}{||{,,,.....))))))}}}}}}|}||,,.,{((((((......))))))},{((({....)))))||||,{(((((((((....,,..,{({,,...}},}||||(({{{{{.{{(((((,({(({(,,,....|}}}}).}})))))}}}},}||||||||}}}}}},,}}}},})}.{||,|||||......})))))))...)))))))))|{{|||(.,,,)))})}},...,,,||,,(((({{(((({((.,...{{,,{,,(((((..,,{{{{....}}}})))))|{{{{{....{((,...,)))....))))))|{(.((((((......)))))),}}|(((.,,,|||},||||....,,|||}|||{{,..,{{}},,,,)},{{{,.|{|||.,|||||{.,,||{{((((({(..,,,|},}))))))),})))})}))))),))))...||||||,,,,,,}))))).,,,{{{{....,|||||.,,|||||||||,,,}})}}}}},..))})))))))}}.,,.((((((((...............)))))))|((((({...}))))),...,,,......}}}.,.,{{,.(((((((((((.......)))))))))))..,,,,..((((((((((.{,,{{(,({(,.,,,.,,.,)),,)),,,,))))))))))..((((((((((((((..{(((,,(((((....))))))))))..,,....,{((((((.....)))))))))))))))}....)))).}}}})))))).))))))}.))))))))))),..,}}},....{..(((((((.((....)).)))))))..).....)))))).)).)))))....{((((..(((((..(({..(((((((........)))))))}))..)))).)..))))}}}||,|}},}}}),)}...........)))))),,)))...(((,.{((.((((.,,...,,)))).))))))...))))))).,))))).)))))|((((({((((((({..,({({.....})))((((.....))))...,,,,((((.,(((((((.(((((..(((((..........{((((......))))}..((({{{({((((((...{((({{{{..{((((.(((.......)))}},)))))..))))))))))}}}))},}}..}}.,((((((({.....{|||.,...|}}|{(((((((......))))))).})}}}}}}}..,......)))))....))))}.))))))).}.)))).,,,,......)))))...))}|)))))},{(({{....{{({....)))}.....})))))))))..))))..)))))}.}..,,,...{{{{....,}}}}.....)))))....)))))))))))))..))....)))))))))}))}....(((((....)))))..{{((((..,|}}}}|((((,,....}}}}((.((.((((....)))).)).)),}}.,,))),,.,,|||}}||||||{,....{{|,,{{{{,{,....,.|||||,,.....},}))){(((((((,,,..(((,{((........)))))).....,.)))))))){{{(((||,,((..,..}}.,..}}}}})..}}.)))}(((((......))))}...,{((,,,,))}}||||......||||||{...}}))}}}}},.{{{{((((((|...{(({,.{(((((.....((((((((((((...(((((.{{..((((({{((((,,(({{{{,,,,,,))}}}}}}}))(((((((((((((((,.,{{,.,,{|,.,{{(({,.,,|||}}|,,{(((((.......)))))}.,,,}}||,,,|||||||,,{{{{,.......,{,....(((((((((((((((((........(((......))).......))))))))))))))))),|||,||||{{{|,,,||||...{{({{{|{{,{{{||({{,||.||||,||||||}|,||||||}}|||{||||.,,||}}|||}}}..}}}||}...,||{{{((((({(({..,,,,,}))))..}}}}}.,{{{||||{{{{,.,,||||..,,...||||.((((...((........))...)))),}},...|},...}|}}}|)}}))}.}))},..(((((((((..((.((((,.(((((((((((...,{{....)}....)))))....))))))..)),,,,}))).....)))))))))...})))))))))))..,......{.(((((((((((((((({{(((({,{((((...............)))))))))))))))))))......))))))).),.{((((((((..,{...........,,))))))))){((((((,....,,,))))}}}.....})))))..}}.)))))....))))))))))))...)))))))))|(((((((....(((((...)))))......))))))),.(((({.((((((.((((.((........)).)))).)))))).....,.,,,({(({(((..{{.(((((((((..(((((........))))))))))..))))......,||,.|,.,....},,},,}})}....}}}||,..{((((.............)))))..}||{|((({{{{{.{||}},,}.,||.|||||},|{..{{{......))},)),,))}),,}}})))))))))}}..{{{|...})))},}||,|||((((|(({{....,}))))))|||||||||,||..,...{{{,,.,{(({((((((.(((,....,))).))))))...)))))))))..,{((,(({....,,))),)))),,,,},......((((((((.......)))))))).{{{{{.....))))},,||..||})))|.....{(((....)))}.,,,{((((({...((((((((((.((((..,((((((((((((((((((((((.,,....,{||,...(({.{{{.(((({({,,(({((.((.....}|,}.,})},,,.)))))}),))}.)}),,}},,.,||{.{{{({,,,.|||}|,.,,,}|.,{{|,,,...)))).,.)))))))))))))))))}.,))))}.,,{{{,,,,||}||,,,.,,{||.,,}})}}},..,,)))).)))).)))))).}||}},,||...{{{,.,,,,|||,.||{{|.|{{(({|{(({{(((({......{{((((.(((,.{((({|{{{{.........))))}}}|(({.(((((((((.......))))))))).))))}.}))).)))))).|||,,,,))}............(((((((((....,,,{(((.,((({..,,{.......}}})))),)))),,.))))))))).........................,,,,,..,,,{||}}}}}...,,,,))},,}},)))}}}.))))),))))})},..}})))))))),,........

Transcripts

ID Sequence Length GC content
GCACACAGCGACUGGAGACGGACGGAGAGCAACGCGCUGGGAGAGGAGA… 5569 nt 0.4164
Summary

This gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The encoded protein negatively regulates wingless/integrated signaling through interaction with the post synaptic density protein/ Drosophila disc large tumor suppressor/ zonula occludens-1 protein domain of Dishevelled, a scaffolding protein required for the stabilization of the transcriptional co-activator beta-catenin. In addition, the CXXC domain of this protein has been shown to bind unmethylated CpG dinucleotides, localize to promoters and CpG islands, and interact with the catalytic domain of methylcytosine dioxygenase ten-eleven-translocation 2, an iron and alpha-ketoglutarate-dependent dioxygenase that modifies the methylation status of DNA. In humans, a mutation in this gene has been associated with development of malignant renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Forensic Context

A review of human population transcriptomics indicates that the CXXC4 mRNA transcript is characterized by higher inter-ethnic than inter-individual variance in lymphoblastoid cell lines from four ethnic groups, identifying it as a potential population-differentiating marker [Daca-Roszak, P.; Zietkiewicz, E. DOI:10.1007/s13353-019-00510-1].