Basic Information

Symbol
CYBA
RNA class
mRNA
Alias
Cytochrome B-245 Alpha Chain P22phox Cytochrome B-245 Light Chain P22-PHOX Superoxide-Generating NADPH Oxidase Light Chain Subunit Neutrophil Cytochrome B 22 KDa Polypeptide Flavocytochrome B-558 Alpha Polypeptide Cytochrome B-245, Alpha Polypeptide Cytochrome B(558) Alpha Chain Cytochrome B558 Subunit Alpha P22 Phagocyte B-Cytochrome Cytochrome B(558) Alpha-Subunit Cytochrome B, Alpha Polypeptide Cytochrome B Light Chain P22-Phox CGD4
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_000101.4
Sequence length
692.0 nt
GC content
0.6806

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-323.70 kcal/mol
Thermodynamic ensemble
Free energy: -334.93 kcal/mol
Frequency: 0.0000
Diversity: 157.97
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((........))))(((....))).(((.((((((((((((..((((..(.(((((.(.((((((........)))(((((.....((((((((((((.......)))).)))).))))...((((((.......))))))(((((....)))))(((((((....((((.(((....))).))))...)))))))..(((((((...(.((..((.(((((((((....(..(((((.(.((((..........((((((((((((.((((((((.(.......(((((............(((((.((((((((.....)))....((((...((((((.....))))))))))......))))).))))))))))....).)))))))).)).))).)).))))))))).).)))))..).))))).)))).))...)))...))))))).(((((.((.(((.((.....)))))..)).))))))))))..(((((((((((.(((..(((((....(((((..........))).))....))))).))).)))))))))))....))).).))))))..))))..))))))...)))))))))(((((((....))))))).(((((.(((((........((((((....))))))........)))).)...))))).
Thermodynamic Ensemble Prediction
...{{(({{,,.||.|,|,,,(,,{{|||.(((.((((((((((((..((((..{,(((((.,,,{||||,,|{,.((({{.|||{,.,||||}}||.(((((.{{.{{|||{||,|||}|||||},((((((.,...,.))))))(((((....)))))(((((((....((((,(((....,}}.))))})}))))))),,|||||,,|}.}}}}}...{(.((((((...}))))).)|(((({(....(((((.(.((((((((((((.(((((((({({{,....{,(((.........,,.{||||,((((((((.....)))....((((...((((((.....))))))))))......))))).|||}},,,))}.....)))))))).)).))).)).))))))))))),,(({..,,.((((....)))),,.}))}...}|||{((.(((((.((.(((.((.....)))))..)).))))),,.....(((((((((((.(((..(((((....(((((..,....,..))).))....))))).))).))))))))))).,,)))))).})))))}.))))..))))))...)))))))))(((((((....))))))).|||||.,|||{......}},|||||,...}}}|||{,.....,)))).}...}}))).

Transcripts

ID Sequence Length GC content
AGUGCGCGCCUAGCAGUGUCCCAGCCGGGUUCGUGUCGCCAUGGGGCAG… 692 nt 0.6806
Summary

Cytochrome b is comprised of a light chain (alpha) and a heavy chain (beta). This gene encodes the light, alpha subunit which has been proposed as a primary component of the microbicidal oxidase system of phagocytes. Mutations in this gene are associated with autosomal recessive chronic granulomatous disease (CGD), that is characterized by the failure of activated phagocytes to generate superoxide, which is important for the microbicidal activity of these cells. [provided by RefSeq, Jul 2008]

Forensic Context

A study in zebrafish demonstrated that the CYBA transcript, categorized as an immunity and cancer-related oxidase, increased in abundance at 24 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].