| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGCGCGCCUAGCAGUGUCCCAGCCGGGUUCGUGUCGCCAUGGGGCAG… | 692 nt | 0.6806 |
Cytochrome b is comprised of a light chain (alpha) and a heavy chain (beta). This gene encodes the light, alpha subunit which has been proposed as a primary component of the microbicidal oxidase system of phagocytes. Mutations in this gene are associated with autosomal recessive chronic granulomatous disease (CGD), that is characterized by the failure of activated phagocytes to generate superoxide, which is important for the microbicidal activity of these cells. [provided by RefSeq, Jul 2008]
A study in zebrafish demonstrated that the CYBA transcript, categorized as an immunity and cancer-related oxidase, increased in abundance at 24 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].