Basic Information

Symbol
CYBB
RNA class
mRNA
Alias
Cytochrome B-245 Beta Chain NOX2 Cytochrome B-245 Heavy Chain Cytochrome B558 Subunit Beta NADPH Oxidase 2 GP91-PHOX GP91PHOX P91-PHOX Superoxide-Generating NADPH Oxidase Heavy Chain Subunit Heme-Binding Membrane Glycoprotein Gp91phox Neutrophil Cytochrome B 91 KDa Polypeptide Cytochrome B(558) Subunit Beta P22 Phagocyte B-Cytochrome CGD91-Phox CGD Cytochrome B-245, Beta Polypeptide Cytochrome B-245 Beta Polypeptide Chronic Granulomatous Disease EC 1.6.3.- Gp91-Phox EC 1.6.3 AMCBX2 GP91-1 Gp91-1 IMD34 CGDX
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000397.4
Sequence length
4276.0 nt
GC content
0.4095

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1187.80 kcal/mol
Thermodynamic ensemble
Free energy: -1276.33 kcal/mol
Frequency: 0.0000
Diversity: 932.34
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.((((.........))))..(((((.(((((((((((((...........((((((((((((...(((((((..((...))..)))).......)))...))))))...)))))).....(((((((((.....((.(((....(((.(((((.((((((..(((((((....((((((((((((.(((.(((...)))...))).))))..........((((..(.......).))))........)))))))))))))))))))))))))).)))((((.((((((.(((((.((((((..(((((...........))))).......(((((((........)))))))(((((((((.(((((.......))))).)))))))))(((..(((.((((((......(((.(((...(((((.((....)))))))...)))..)))(((((((((........)).)))))))(((((.((((((..((((((((..(((...(((((..((((((((.(((((((((.........(((((((((((((....(((((...........(((((((...(((((.............))))).........(((((((((((...((((((((.(((((((((.((..(((((((((((..((((.((((..(((((((.((((((.(..((((.....))))..).))))))(((((..........))))).((.((........)).))((.((((................)))).))..)))))))..))))....((((.((((..((((.((((((((((((((((((..((((((...(((((..(((((((.(........).))))))).))))).((((((((((.....)))))))))).((((((((.....((((........)))).....)))))))).....)))))))))))))..........(((((.(((......((((.(((........)))))))......)))))))).))))..((((((((...))))))))))))))).))))..)))).))))........((((((((..((((((((....(((......)))(((((((((..........)))))).))).....))).)))))..))))))))))))..))))))))))).((((.((((..((((((((((.(((.(((((((((.((.((((((((...))))......(((.(((.....((((..((((.........((......)).))))..)))).........((((((....((((((((((((........)))).)))....))))).....)))))).(((((.(((((....)).))).)))))))).))).)))).)).))))))...)))))).)).)))))))).(((((((((....))))).))))........)))).)))).)).)))))))))..))))))..........))...)))))))))))(((.(.((((((((.((((..............(((........)))............))))..(((((((((((((.((((((..(((((.(((((........)))))........(((.((((....(((((.......)))))))))))).)))))..))).))))))))))))))))..((((.(((((...))))).))))...)))))))).)))).....((.........))....)))))))................((((((((.(((.((((..((......))..((((((((.(((...(((((((.(((((((((((((..((((....)))).....(((((((((((.........)))))((((((((..((((((((................))))))))..))))))))..(((...(((((..(((.(.((.(((((.((((...((((((.(((((....)))))......))))))..)))).))))).)).).))))))))..)))(((..(((...)))..)))......))))))...(((((....))))).....)))))..))))))))))))))).......)))..))))))))(((((((......))))))).)))).)))))))))))((.(((.(((....))).))).))......(((.........)))(((((((..((((((((...))))))))..)))).))))))))..))))).........)))))))).........))))))))).))..))))))(((((((((.....)))))))))(((((((..(((..((((....((..((((((((((.((....(((((...(((........)))...)))))..)).)))))).))))))....))))..)))..)))).)))(((((((.((..(((((....)))))..)).)))))))..((((.....))))....((((..(.((((..(((............)))..)))).)..)))).....((.......)).)))))....)))..))))))))....)))))).)))))...............(((.((((((.........)))))).))).)))))).))))))..(((((.(((...((((........))))..))))))))..)))))).))..))).))))))...))))....))).))......)))))))))....(((((..((((.......)))).))))).((((......))))....))))))))))............((((((..(((.....))).))))))....(((((.((.......)).)))))...................))).)))))........((((((....)))))).....(((((((.((((((......(((((....)))))(((((...))))).....)))))))))))))....(((((.(((((((((((((((((((((.(((.(((((....))))).((.((((((((((..(((((((..(((((((......))...((((.....(((((..(((((....)))))..))))).....)))).)))))..))))))))))))))))).))..((((((((((.(((((((((((((..(((..(..(((((((..((((((((((.((((((((((....((((.(((((((..(......)..))))))).))))((((((...((((((((((((.((((((...(((((((((.(.......((((....))))).))))))))))))))))))))))).))))..))))))(((.(((((...(((.((((.(((((((.....((((((.(((..(((.......((((((......))))))..)))..)))...))))))..))))))).....((((((....))))))((((((((........))))))))(((((..((((((((.(((((........))))).))..........((((((..((((...((((((((((....((((...(((((((.................)))))))...))))........)))).))))))...)))).))))))..(((..(((......))).))).((((((((((..(((((...........))))).......))))))))))..)))))))))))........)))).)))))))).)))((..(((.....)))...))((((((((.((((.(((.......))).)))).)))))))).))).))))...(((((((....)).)))))..(((((...((((....))))))))).......))))))))))))))))))))..)..)))((((.((((............)))).))))....))))))))))))).)))))))))).....((((((.........)))))))))....))))))))))).))))(((.(((((.......))))).)))......((((((((.((((((((((((((((..(((((((.......))))))))))))))....................))))))))).)))))))).(((((((...)))))))...)))))).)))))...........)))))).......
Thermodynamic Ensemble Prediction
.((((((.((((,,....,,.))))..(((((.(((((((((((((.....{,,.,,{{((((...(({{{((((((((..((,,((({{{{{{,,,{{(((((...)))))}.....|,....,.|||{{{((((({......}})}},,|||,|{(((.((((((..(((((((....((((((((((((.(((.(({...}))...))).))))........,.((({..{.......,.))))........))))))))))))))))))))))))}),))))),,.||||||.{{(((.((((((..,((((.,,.....,,.))))|...{{,{(((((((........)))))}}(((((((((.(((((.......))))).))))))))),{{..(((.((((((......(((.(((...(((((.{{....}})))))...)))..))){{{{({({{.......,}}.,}}}|||(((((.((((((..((((((((..(((.,,(((((..(((((({{.(((((((((.........((((((((,{,,,.,,.{{,{{{,,.,{{{,,...,.......(((((.............))))).........(((((((((((....,((((((.(((((((((.{{..(((((((((((..(((({((((..((((((({(((((({(..(((,{{{{.|||}..,.,}},))}||||.}}}......)))))}}}},,........,|,|.{{.((((.,............,.)))).))..)))))))..))))..,{((((.((((..((((.((((((((((((((((((..((((((...(((((..(((((((.(,.......).))))))).))))).((((((((((.....)))))))))).((((((((.....((((........)))).....)))))))).....)))))))))))))..........((((,,(((...{({(((({(({........})))))),)),..)))))))).))))..((((((({...})))))))))))))).))))..)))).))))...,,...{(((((((..((((((((,{{.(((......)))(((((((((........,.)))))).))).....})),}))))..))))))))))))..))))))))))).((((.((((..((((((((((.(({{(((((((((.((.((((((((...)))),,,(((((,.(((({.{({((({,((((,,,......{{.,....||,||||..,}||.{,{,....{{{......))}..,((({{{|,,......})}}.)}),}}}}))||,||||||...,.|)})}}}}})}.)))))..,))))),)}}......)))).)).))))))...)))))).)),)})))))).(((((((({....}))))}})))........)))).)))).}}.)))))))))..)))))).,,,......))}..)))))))))))|||.(|{(((({({.{,(({....{{{.,,{{{,,,..}}}.,,,))}...,}}......,||..(((((((((((((.((((((..(((((.,.,,({{....{{{{{||........(({.((({....,{|||..,....))))))))))}).,))))..)))},)))))))))))))))..|||{,{{{{{...))))),,,,,,,,))))))))})})),,.(((((((..{((((({...{((((({{............,..,{({{(((({(({((((..{{.,,...||..((((((((,(((...(((((((.(((((((({((((..((({....|},},....(((((((((((.......,.)))))((((((((..((((((((................))))))))..))))))))..(((...{((({{,(((.{.((.(((((.{(((...((((((.(((((....)))))......))))))..)))}.))))).)).).))))))))..)))(((..(({...)))..)))......))))))...(((((....))))).,,..)))))..))))))))))))))).....,,,,}..))))))))(((((((......))))))).)})),))))}))))))}},,...)))))))}...{{{.(((,...})))...}}}.,,,,,{,(((((..((((((((...))))))))..))))))),.,))))))).....))))))))))))))).........))))))))).}}..))))))(((((((((.....)))))))))(((((((..(((..((((.....,..((((((((((.,({,.,(((((,..{{(........))),,,)))))..,),))))))},))).}....)))}..)))..)))).)))(((((((.{{..(((({....)))))..}}.)))))))..((((.....))))....((((..{.((((..(((............)))..)))).}..)))),.,.,{,...,,..}|.))))).,,.)))..))))))))....)))))).))))).,,,........,,.(((.((((((.........)))))).))).)))))).)))}}},,((((,{(((...((((........))))..))))))))..}))))).))}.,}}.})),,)}))))))))}),..}})}.....},,.,|||||...{{(((..{{((,......}}}}.))))}.{{||......}}},....))))))))))...,,....,,.((((((..(((.....))).))))))....{((((.,,..,,...,,.,,}),...................))).)))))........((((((....)))))).....{((((((.((((((......(((((....)))))(((((...))))).....))))))))))))}....(((((.(((((({{{{{((((((((((..{{.(((({....))))).((,((((((((((,.{((((((..(((((,,.{{{..,....||{,....{(((((..(((({....}))))..))))}})...},)),)))))..)))))))))))))))))}),,,((((((((((.(((((((((((((..(((..(..(((((((,.{(((((((((.({.{((({(({{..((((.(((((((..(.....,)..))))))).)))){((((|.,.{({(((((((((.((((({..,(((((((((,(,.,,,,,{,,,..,,|}|}}.))))))))))))))})))))))).}))}.,}))))}({,.(((((...{((.((((.(((((((.....((((((.(((.,(((.......((((((......)))))).,))),.)))...))))))..))))))).....((((((....))))))((((((((........)))))))){({({{,,,,.{(((.(((((........))))).)))},|,,,..,||||((,.(((({..((((((((((....((((...{((((((.................))))))}...))))........)))).))))))..,,|,,.,|||||..,.{,,(,,...,,,),},))),((((((((((..(((((.........,.))))).......))))))))))}}))),)))}}}}........)))).)))))))).)}}|,{{({{...})))),.{((((((((((.((((.(((.......))).)))).)))))))}}))).))))...(((((((....)).)))))..,((((..{((((....)))))}})),,.....,},)))))))))))))))))..)..))}((((.({((.....,..}...)))).))))....)))))))))))))}))))))))))..,..{{((((..,......}}}}},.,}}),.)))))))))}}.}}}}(({.(((({.......))))}.}))...,,.{(((((((.((((((((({((((((..{{(((({,,,....}}}}}}}}))))}|...,||..,,,,}.....,.))))))))).)))))))}.{((((((...))))))}...}))))).)))))...........)))))).......

Transcripts

ID Sequence Length GC content
ACAUUCAACCUCUGCCACCAUGGGGAACUGGGCUGUGAAUGAGGGGCUC… 4276 nt 0.4095
Summary

Cytochrome b (-245) is composed of cytochrome b alpha (CYBA) and beta (CYBB) chain. It has been proposed as a primary component of the microbicidal oxidase system of phagocytes. CYBB deficiency is one of five described biochemical defects associated with chronic granulomatous disease (CGD). In this disorder, there is decreased activity of phagocyte NADPH oxidase; neutrophils are able to phagocytize bacteria but cannot kill them in the phagocytic vacuoles. The cause of the killing defect is an inability to increase the cell's respiration and consequent failure to deliver activated oxygen into the phagocytic vacuole. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the CYBB gene, a reactive oxygen species-associated marker, was significantly increased in female microglia compared to male microglia after spinal cord injury, and was also increased in 14-month-old microglia compared to 4-month-old microglia, with expression higher in monocyte-derived macrophages than in microglia [Stewart et al. DOI:10.1186/s12974-021-02161-8]. In a rat model of radiation-induced lung injury, single-cell transcriptomic analysis identified the orthologous rat gene for the CYBB as being associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].