| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCGGCCGCGCGGAGGAGGCCAAGAUGGCGGCAGCUGCGGCUUCGCUUC… | 1191 nt | 0.6154 |
This gene encodes a subunit of the cytochrome bc1 complex, which plays an important role in the mitochondrial respiratory chain by transferring electrons from the Rieske iron-sulfur protein to cytochrome c. Mutations in this gene may cause mitochondrial complex III deficiency, nuclear type 6. [provided by RefSeq, Dec 2013]
A study in mice demonstrated that the CYC1 gene, encoding cytochrome C-1, was downregulated in brain tissue at 8 and 24 hours after whole-body ionizing radiation exposure, with fold changes of 0.454 and 0.422 respectively, indicating a significant metabolic response to radiation injury [Zhao et al. DOI:10.1158/1078-0432.CCR-05-2418]. In human post-mortem tissues, the CYC1 gene was downregulated as part of the inhibited respiratory electron transport pathway in the prefrontal cortex, hippocampus, kidneys, and heart of sepsis patients, highlighting its role in metabolic dysfunction during septic shock [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].