Basic Information

Symbol
CYP1A2
RNA class
mRNA
Alias
Cytochrome P450 Family 1 Subfamily A Member 2 P3-450 CP12 Cytochrome P450, Subfamily I (Aromatic Compound-Inducible), Polypeptide 2 Cytochrome P450, Family 1, Subfamily A, Polypeptide 2 Hydroperoxy Icosatetraenoate Dehydratase Cholesterol 25-Hydroxylase Cytochrome P450 1A2 Cytochrome P(3)450 Cytochrome P450-P3 Cytochrome P450 4 EC 1.14.14.1 CYPIA2 Flavoprotein-Linked Monooxygenase Aryl Hydrocarbon Hydroxylase Microsomal Monooxygenase Xenobiotic Monooxygenase Dioxin-Inducible P3-450 EC 4.2.1.152 P450 Form 4 P450(PA)
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_000761.5
Sequence length
3132.0 nt
GC content
0.5338

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1141.50 kcal/mol
Thermodynamic ensemble
Free energy: -1191.56 kcal/mol
Frequency: 0.0000
Diversity: 817.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.(((((.............((((((((.......(((((.((((((....((((((((.(((...(((((.(((((.(((((.((((((......))(((.(((((((((...((((((((((((((....))))))(((((((((((((.((((...((.(((((..((((((..........))).))).)))))))))))...(((((((((((.(.(((((.((((((((...(((((((.(((.(((((..(((((..((((((((.((((.....))))(((..((((((.(((.....))).)))).))..))))).)).))))....)))))))))))))..))))))).((((((.....(((..((((((((..................((.(((....))).))((((((((((........)).)).)))))).((((((.((....)))))))).))).))))).)))))))))......))))))))..(((.((((((((.(..(((..((((((........))))))...((((((...(((((((.((((((((.(((.(((.((....)).))).))))))))))).))).))))....))))))...))).).))).))))).)))....(((((((((....(((((((.((((((..........((.(((((((.(.((((......(((((((.......))))))).....((((.....))))((((((.....)))))).........))))).)))))))))((((((((((((...)))).))))..))))...........(((.(((((((((((((........(((((..((......)).)))))..((((.......))))))))).)))))))).))))))))))))))))((((((((((((.....)))...(((((.((..(((....)))..)).)))))..((((((((((.((((((..((((..((...((((...))))......))..)))).))).((((.((((.(((((......))..))).))))))))....(((((......)))))...))).))))))))))((.((((((...((.(((.....)))))...))))))))..(((((((.(((((...))))).)).))))).......)))))))))..............(((((((......((((......(((....))).......)))).......))))))).........))))))))).))))).))))).))).)))).(((((((((.(((((.(.((....))).))).)).))))).)))).((((((...))))))..))))))))))))).))))))))(((((....))))).(((....)))(.((((.(((((......((((((...((((((......))))))))))))))))).)))).)...(((((...((((((((((((((((((...((((.((((...........)))).)))).......))))))))(((.((.....)))))..))))).))))).)))))........((((..........)))))))))))))))))))).))))).)))..)).)))))...))).(((((..........................)))))..(((((((.(((..((((((((((((((((((((((.((((((..((((.((.(((((((..(((..(((((..((((.(.((.(((((((((((((((((((((.(((((((((((((((((((((.((....((((((.(((((((((.(((((.(..(((((((((..........((.((((((((((((..((((((((....))))))))........((((((((......)))....)))))...............)))))))))))).)).((((((.......))))))....((((.(((((((((((((.((....)))).)))))))..))))))))...(((((.(((...........))).))))).....(((((((((((((((((.((.(((((.......))))).)).)))))))))))))((((..((((((((((((.(((.((((((((..((....((((..((....))))))....))..))).)))))(((((......)))))..))))))).))))).)))..)))).......(((((((....((((........))))..)))))))....))))..........(((((..........))))).....)))))))))..).))))).)))))))))))))))((((((.(((((.((.......))))))).))..))))((((.....((((.(((.((((....((....)).....)))).))).))))...)))).((.((((...)))))))).)))))))...))))).))))))))).))))))))))))))))))))).)).).))))..)))))..)))))))))).)).))))..)))))).)))))))))))))).))))))((((.((((.(((((((((.................((..(((((((((.....)))))))))..))))))).)))).))))..))))....((.....))(((((.........)))))...((((((....((.((((((..(....)..)))))).))..))))))......)).))).)))))))..))))))))....)))))).)))))........)))))).))....(((..........))).....((((..((((.((((.((......))..)).)).)))))))).)))))))))...(((((..((...........((((((................))))))....))..))))).(((((((((......................((((....(((......)))....)))))))))))))((((((..(((((....((.....))..........(((((((....))))))).)))))..))))))..
Thermodynamic Ensemble Prediction
.{(({,(((((.{{,.......,,,(((((({,,..{{((.(((......}}}.,|{,{{|||||||,..,,,|||,|||||,{|{,....({{{|||{{{,,.|}|,}})|},,,,.((((((((((((((....))))))(((((((((((((.((((...((,(((((..((((((..........))).))).)))))))))))...(((((((((((.(.(((((.((((((((...(((((((.(((.(((((..(((((.,((((((((.((((,...,))))(((..((((((.(((.....))).)))).))..))))),,)}}))).,..)))))))))))))..))))))).((((((.....,,{.,((((((((..,...{(((((((.....,.(((....})).||(((((({(((........,,.)).)))))).}})))))))}...}..)))))),))}}},,,.,,,))))))......))))))))..(((.((((((((,({.(((..((((((........)))))),..((((((...(((((({.((((((((.(((.(((.((....}},))).)}})))))))).})).))))....)))))}..,})).)|))).))))).)))....(((((((((,,..{((((({.{{{{|||||..{{{,,((.(((((((.(.((((......(((((((.,....,))))))).....((((.....))))((((((.....)))))).........))))).))))))))}((((((((((((...)))).))))..))))..,....{{{{({.{((((,{(((((((..,.......}|))))))}.,...)))))))}}|,,..,,,,,{||||||}}}.,,,,}))),)}.))))))}}|||||((({{{{((((..,,({({{,.{(((,,.{(..(((....))},,}}.|||||,.{((((((((,.,,{{{{|,|,.,.})),,,||||},,|||,...{{{{|.,||||{|{{.((((.((((.((((,,.....,)..))).))))))))....|||}|.,)),}})))....,||||}}|||||||((.((((((...((.(((.....))),),..)))))),,..(((((((.(((({...})))).))}})))).....,,})))))))),..,,,,.......{{{{{{{......|||{......|||,..,)))..,,,..}))),......))))))).........))))))))).))))).))))).))).)))).((((((((({({(((.(.{{....})).))).)),})))).)))).((((((...))))))..))))))))))))).)))))))).|||||.,}}|)|.}||{..,.))||}}|}..,||||,,||||((((((...((((((......))))))))))))..,|||,,}}))}..(((((...((((((((((((((((((...((((.((((...........)))).)))).......))))))))(((.((.....)))))..))))).))))).)))))......,.,||{|||||.....,}}||||||,}|||||||}||||||(,|,|..,,(((({{,..{|,,,,|,,....................{||||,||{{{,.,,,{{,{.((({{((((((((((((((((((((((.((((((..((((.((.(((((({.,(((..(((((..((((.(.((.(((((((((((((((((((((.((((((((({(((((((((({.((....((((((.(((((((((.(((((.(..(((((((((.........,((,({((((((((({..{(((((((,...,))))))),.......((((({{(,,....}}},,,.)))))..............,)))))))))))).)).((((((.......))))))..,.((({{(((((((((((((.{{....)})).)))))))..)))))))}.{.{((((.{((...........))}.})))}{{,,.,.,,|}))){(((((((.((.(((((.......))))).)).))))))))},|||((((..((((((((((((.(((.((((((((..((....((((..{(....)}))))....))..)))},))))(((((......)))))..))))))).))))).)))..))))..,,}}.{{{(({{,...{{{{,,,....}))}}..))))})).,,,}}},..........(((({.,,.....,,))))).....)))))))))..).))))).)))))))))))))))((((((.(((((.((.......))})))).)}..))))((((.....((({.{((.{{{{...,((....}}.....}}),.))),))))...)))).{{.((({...)))))})).}))))))...))))).))))))))).))))))))))))))))))))).)).).))))..)))))..)))))))))).)).))))..)))))).)))))))))))))),,))))},(((.((((.(((((((((.................,,..(((((((((.....)))))))))..}}))))).)))).))))..))}}.,,,{|,,|||}}|,,,,.,|}.....|}))}...({(({,....||,((((((..{....)..)))))).},.,||||}}.......|.}}}}))|||||...,,,},}},))})}.((({(|{(({{,,(,,.,.})),,||}},.||}}}....,.,}},}|,,..||||..{{||.|{||.{{......}}..}).)).)))}}}}),))))))}}}...({{{{,.||,..........((((((................))))))..,.))}}))))}.,{{{|||||,,,,........,,,,,..,,.||{{,,,,{{|,,,,,.}}}....|||}}}})))),,{{{{{{..{||||,,..|||,,,.}}..,,......(((((((....))))))).,}}}}..))))))..

Transcripts

ID Sequence Length GC content
AGCUCCACACCAGCCAUUACAACCCUGCCAAUCUCAAGCACCUGCCUCU… 3132 nt 0.5338
Summary

This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. Other xenobiotic substrates for this enzyme include caffeine, aflatoxin B1, and acetaminophen. The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that major blunt trauma triggers a selective and sustained alteration in oxidative enzyme gene expression within circulating leukocytes, with the CYP1A2 being among the top ten down-regulated genes following injury [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f].