Basic Information

Symbol
CYP1B1
RNA class
mRNA
Alias
Cytochrome P450 Family 1 Subfamily B Member 1 CP1B Cytochrome P450, Subfamily I (Dioxin-Inducible), Polypeptide 1 (Glaucoma 3, Primary Infantile) Cytochrome P450, Family 1, Subfamily B, Polypeptide 1 Hydroperoxy Icosatetraenoate Dehydratase Cytochrome P450 1B1 EC 1.14.14.1 CYPIB1 GLC3A Flavoprotein-Linked Monooxygenase Dioxin-Inducible Cytochrome P450 Aryl Hydrocarbon Hydroxylase Microsomal Monooxygenase Xenobiotic Monooxygenase EC 4.2.1.152 P4501B1 ASGD6
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Mechanical injury analysis

MANE select

Transcript ID
NM_000104.4
Sequence length
5218.0 nt
GC content
0.4396

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1608.70 kcal/mol
Thermodynamic ensemble
Free energy: -1705.20 kcal/mol
Frequency: 0.0000
Diversity: 1454.08
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((.(((((((((((((((....))))))...))))).((((((((.((((((.(((((((((((((((((.(((.....(((.....)))...........(((((((((...))))).....((((((.(....(((((((..(((((((.(.(((((((((......(((.(((((((((..((((((((.(((.((((.........)))).)))((((((((((((((....))))))((.(((((((((.((((((((.((((((..(((((..(((.((.(((.(.(((((...)))))).)))...(((((.....))))).(((........))))).)))..)))))....))))..)).)))))))).((((((((.............(((((((...((((((((.......((((.(((.((.((.((.......)).)).)))))...))))))).)))))..)))))))))))))))..(((.((((...((....))...)))).)))((((((....)).)))).............((((((.((((((((((((((((..((.....))..)).))))))))((((((((.(((..((((((((((((((((((.((((....))))....((.((((((...(((..(((((((...((((((...))))))..(((((((.(((((..........)))))))))).)).....((((.((((((.((((.(((((.....))))).)))).)))))).))))(((((....)))))...))))))).)))..)))))).))((((...........((((((((.((...(((((((.(..((((.(.(((.(((.....))).))).).)))))))))))))).))))))))(((((((((((.(((((((..((...((((((.((((((........)))))).))).....)))..))))))))).)))....))))))))....(((((.((.....((((((((.((((((((((............(((((((((...((((((.(((((((.....(((.(((.(((.(((.......))).))).)))))).))).)))).))))))...)).)))))))))))))))))..((((.((((((.((((((......))..)))).))))))...))))...(((...)))((((((.....))))).).......((.(((((((.(((.......)))...))))))).)).))))))))....)).)))))))))))).))))))))))))))).)))............((.....)))))))).))((((....)))).))))))))))))....))))).))))))((.(((((((...))))..))).))))))))))....))....))))))..))..))))))).))).....)))))))).).).)))...))))...)))))))..).))))))..........(((((.....)))))..))))...)))..)))))..))))).)))))).)...)))......(((((..(((((((((........(((((((......))))))).....((((((((((.....)).)).))))))..)))))))))..)))))..(((((.(((((........))))))))))..))))))).))))..(((((((((((((((.((((((((...((((.(((((...((((((((((..((.(..(((((....((((.((.(..((((((((((((((((.((((((((...(((.((.((((..(((....)))))))..)))))...((((((.(((..((((((((...)))))..)))..))))))))).........(.((((.((((.((((.......)))).)))).)))))...............)))).))))..((((((..............))))))((((....))))................)))))))))))).))))..).)).))))...)))))).))..)))))))))).................(.(((((((..(((.(((.....))).)))..))))))))...(((((.((((((((((.(((.....)))))).))))))).))))).....((((((((((...))))))))))))))).))))..))))).)))...))))....))))((.(((((((((......))))))))).))....(((((((((.(((((.((.(((((........((((((.(((((.......))))).))))))..(((((..(((((((((((((..(((....)))..))))))...)))))))........((((((((((....((((.((.(.(.(((..((((((..((........))..)))))).))).).).)).))))((((((((.(((((((.................))))))).))))))))...((((.(((.(((((..((((((....((((((((((((((((((.((((....))))...............)))))))))))....((((((..(((((...........((((((....(((((.((((..((((((((.((((....))))))))))))..)))).)))))...)))))).........(((((......))))).(((((((...((((........)))).......))))))).........(((((.......)))))..((((((....))))))(((((..((((((((.....((.((((............((((........)))).((((((((.((((((.(((...(((((.(((.......))).)))))..)))...)))))).)))))))))))))).....)))))))).......))))).....((((......))))........)))))))))))........))))))).(((((...(((((.(((((...))))).)))))....))))).(((((......)))))))))))..))))).))).))))((((((((.(((((((.(((((.((......)).))))).)))....)))).))))))))......)))))))))).........((((((((((((((((((((((.....))))))..))))..(((.(((((((((.(((.....))).))))))...))).)))((((...(..(((.(((((.((.........)).)))))..)))..)...))))....)))))))))))).)))))...(((((.((((...)))).))))))))))...(((((((((..(((((((((((..(((((((((((.((((((((((.((((((...((....))...))))))..))))))))...))))))))...........(((((((.....))))))).)))))..)))))))))))(((((((((((.........(((((((.(.((((...((.((((((..(((((((((((.(((((..(((((((...(.((....(((.((((((((((....((.....))....)))))).....)))).)))..)).)...)))))))...)))))....))))))))))).)))))).))...)))).)))))))))))))))))))))))))))).....))))))).)))))))))((((((((..(((((((((((.(..((((((.(((.((((.......((.((((((......)))))).))..((.((((((((.......((((((........))))))........))))))))))..((.(((((((........))))))).))...((((((........)))))).......((((.((((((((((((((((((((.((((((.................)))))).)))))).)))........................(((((..((....))..)))))(((......)))))))))))))).)))).))))...)))...))))))..).))))))))))).........))))))))..((((((((.((((........)))))).)))))).....(((((((((....(((..((..........))..)))....))))))))).................))))))).....(((((((((......((((....))))((((((.((((....)))).))).))).....(((((((.(((((...(((((((((((((..(((((((((((.....(((((.................(((..........)))...............(((((((((...............((.(((((((((...((((.(((((((((((((.......((((.(.(((((...))))).).))))......))))......)))))).))).))))))))))))).))...((((((((........)))))....))))))))))))......)))))..)))))))..))))..))))))))))))))))))...(((..((.((((.....)))).))....)))...))))))).((((((((................((((((.(((((.............(((((((((..((((((...))))))..(((((((((((((((((((((......))))))))....))))))...)))))))..((((((((((((..(((.(((...........))).)))..))))).....)))))))............((((((((.((((((((((....(.((((.((......)))))).)))))..)))).)).))))))))..)))))))))............))))))))))).(((((......)))))............(((......))).....))))))))..............((((((.....(((((((((...))))))))))))))))))))))))...((((((((..(((..................)))..)))))))).((((......)))))))).))..
Thermodynamic Ensemble Prediction
,,,,,(((((((({(((((((((,.,,||}}}}})|,||||,((((((((,((({{{.{(((((((({{{{({{{.{{{.,...{{{..,,,})).....,,,.,.(((({((((...))))}.....((((((.{....(((((((..((((({(,(.{((((((((..,...(((.(((((((((..((((((,,.(((.((((.........)))).}}}((((((((((((((....))))))|{.(((((((((.((((((((.((((((..(((((.,(((.({.(((.(.(((((...)))))}.)))...(((((.....))))).(({.,....},)))}}.)))..)))))....))))..)).)))))))).((((((((.............(((((((...((((((((.{,.,{{((((.(((.((.{{.||.......)).)),)))))...})),))).)))))..)))))))))))))))..{(({(({(,,.((,,|{||{,{}|}}.}}}{{{{{{...,)),))}}...,..,}}..,|((((({{((((((((((((((((..((.....))..)).))))))))((((((({.(((..((((((((((((((((((.((((....))))....{{.{(((({...|||..((((((({.{((((.(((((((......))))))}{((({...|||,..,||},||||,,{|||{{{,((((.((((((.((((.(((({.....})))).)))).)))))).))))|,...||,,)))}|,{,|||||||,||}..}}}}}}.,)||||...........((((({{(,((((.(((((({.{.,({{{.(.(((.({{,,,..))).))).).)))))}))))))}),}}}))))}|||||,|||||,,{|||||,,,,|,{{..,||}||||||,}..{{{{|||||,{|||{....}.,..}.}}||||}.},,..}}))}))})),,}.|||||}||}....((((((((,((((((((((............(((((((((.,.((((((.(((((((,,,,,{((.(({.{{,.{{|,..,,,,))}.,}}.}))))}.})),}))).)))))).,.)).)))))))))))))))))..((((.((((((.((((({......}}.,)))).))))))...))))...(((...))),{{{((.,.,,}}|||,|....,,,((.{{{{{{{.||{.....,.))}...))))))),))}))))))))...}))})))))))))))).))))))))))))))).))),.,........,{,.....,|)))))).))((((....)))).)))))))))))).}},))))),)))))|((.(((((((...))))..))).)))))))))),,.,),....))))))..))..))))))).)))..,..)))))))).}.}.)),,.}))))...)))))))..).))))))..,,......(((((.....)))))..}))).,|||},,|}|}|,,|||||,|}}}||.|,,{}}}......(((((..(((((((((((((.(((...)))...))))}}..........(((((((({(.....)).))}))))))..}))))))))..)))))..(((((.(((((........))))))))))..|||||}}.},,,.,||,}}((((((((((.((((((({...((((.(((((...((((((((((..{{.({.(((((....((((,{{.{.,((({((((((((((((.((((((((..,(((.((.,,{{..(((....))).,,}..))))).}.((((((.{{{..((((((((...)))))..)})..}}})))))).........{.((((.((((.((((.....,.)))).)))).))))},,,............))))}})))..((((((..,........,..)))))){(((,...},,}.....,,,........)))))))))))).))))..,.)),))}}...))))),})}..)))))))))}.......,.{......,{|(((((((..(((.(((.....))).)))..))))))),...(((((.((((((((((|{((.....)))))).))))))).))))).....{(((((((((...)))))))))}))))).))))..))))).}}),}.))))....)))))}.{({((((((......))))))))},,.....(((((((((.(((((.{(.(((({,{.,,,..((((((.(((((.......))))).))))))..{((((,,(((((((((((((..(((....)))..)))))}...}}}}}}}.,......{(((((((({,,...||||,..|||}},||{{{{{{({{(,{{{{{{..{{.(((((,{{{{{{{{{{{,(({,,((((((((.(((((((.................))))))).)))))))}}}},{,,.{{{,(({{{..{{{|||....{(((((((((((((((((.,{{{....||}}...............)))))))))))....{(((({..(((((.........,,{{{{({,,.,(((((,((((..(((((((,{((((....))))))))))))..}))),)})))}}.}}}}}}.....,.,,{{{(({{{,,,|||,|{{{{(((({,.,,||||..,...}}}}......,)))}}}},........(((((.......)))))..,(((((.,,,}}}}}},(((((.,,,|||||.,,,.||,||||,...........(((({.....,.)))).((((((((.((((((.(((...{((({.(({.......))).})))}..)))...)))))).))))))))})}}}),,,,.))))},,..,}....||||||,{,.,,{{.....,))))}}}.....)))))}))))}........))))))).||{{|},,{||||,{{{||...))))),)))))}},.}}}}|{(((({.,....|}}}}}}}})),.}}}}||}||.,},|{{{{{{{{.{||||||.{{{{{|{{,...,|}}.}}}}}.})}....)))},)))))))),.....|}}}}}}))}.....,,,,((((((((((((((((((((((.....)))})),.))))..{((,,{{(((({{.(((((.,.|||.||)|)}},,.}),}},|,|||,.,,,|||,{(((({(,,........,,.),)))}))}}..,},,}}))},..)))))))))))).}}))),.,{((((.{{{{.,,)))),))))))))))..{(((((((((..(((((((((((..(((((((((((,((({((((((((({(((...{,....}}...}}|||},,}))))})),..))))))))..,,,..,,,,{((((((.....))))))}})))))..)))))))))))(((((((((((.........(((((({,(.((((...((.((((((..(((((((((((.(((((.,(((((((...(.((....(((.((((((((((....((.....))....)))))).....)))).)))..)).)...))))))).,.)))))....))))))))))).)))))).))...)))).)))))))))))))))))))))))))))),}...}}))))).)))))))))||||{||{|||||||||{{{{.|..{{{{{{,,...,{{{....|..(({((((((......)))))))),..||.{(((((((,.....,||||||........}}}}}},,.,,,,,|}}}}}}},..||||||{{{||,,..,.|||}},,,,,))...((((((,.......}}}}||,,,,,,.((((.(((((((((((,{{((({{{.{{{{{{.{,...,,{..,{{{{{,}}))),))},)},,|.,|......,,|,............{((((..{{....))..))))},,|,,,,,.,,.))))))))))),)))),}||},.,}}}...}}}}}},,|.}}}))))}}}}.........,|}}}}}},.{({(((((,((((,.....,,|||||}.}))))}{{{{{((,,...,}))))}}}.,,.{{({{{{...,.{{{,{{{....,,((((..(((({{.,{{{{.,..|||||.{(({{...,,...)))))..,,,}))})}).))))))}}.,{||.},,))),.)))}))).....{{{{{{{.{((((...(((((((((((((..(((((((((((.....(((((...,..,..,{,..,..{,,.}},,,,,..}}}...............(((((((((.....,,.....,,.{{.(((((((({..,((((.(((((((((((((..,....((((.(.(((((...))))).).))))...,..))))......)))))).))).))))))))))))).)}..,{{({{{{(,,,.....}}})),...})))))))))))..,,..}))))..)))))),.}))))..)))))))))))))})))}...{{{|,||,||||}}}},}})},}}....}}}.,.})))))).{(((((((.....,,...,,,...{{({{(.({{{{,,,,.........{{{{(((((..((((((...))))))..((((((((((((({{{((({{......}}))))},....)))))),,,|}}}})),,(((((((((((({.(((.(((,........,.))).))).})))))}....,))))))............((((((((.(({{{{{(((...,{.((((.((......)))))).})))}..))}).)).))))))))..))))))))}............))))))))))).|||{({.{{{,,}|}|,.........,,|||}.,,,.,}}...,.)))))))}..,,,.......,,,,,......{{{((((((((...)))))))))},})}))))))}}}....||||||||..{{{......,..........,|||..||}|,|||,.......,}}),),)),,}))..

Transcripts

ID Sequence Length GC content
GACUCUGGAGUGGGAGUGGGAGCGAGCGCUUCUGCGACUCCAGUUGUGA… 5218 nt 0.4396
Summary

This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The enzyme encoded by this gene localizes to the endoplasmic reticulum and metabolizes procarcinogens such as polycyclic aromatic hydrocarbons and 17beta-estradiol. Mutations in this gene have been associated with primary congenital glaucoma; therefore it is thought that the enzyme also metabolizes a signaling molecule involved in eye development, possibly a steroid. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the CYP1B1 is significantly upregulated in sepsis, with animal experiments confirming increased protein and mRNA expression levels in septic mice compared to sham controls, indicating its association with elevated oxidative stress activity [Tao et al. DOI:10.1007/s10753-025-02346-w]. In human studies, the CYP1B1 was transiently up-regulated in circulating leukocytes following major blunt trauma [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f].