| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCGACCCAAAGGUGCAGGCGCGCGAGCACAACCCAUGGCUGCGCUGG… | 1895 nt | 0.5826 |
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein oxidizes cholesterol intermediates as part of the bile synthesis pathway. Since the conversion of cholesterol to bile acids is the major route for removing cholesterol from the body, this protein is important for overall cholesterol homeostasis. Mutations in this gene cause cerebrotendinous xanthomatosis, a rare autosomal recessive lipid storage disease. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the CYP27A1 is significantly upregulated in blood samples from acute myocardial infarction patients and validated as a diagnostic biomarker with an AUC of 0.771 [Xu et al. DOI: 10.1097/MD.0000000000045611]. In contrast, a separate investigation in humans found that the CYP27A1 was among the top ten down-regulated genes in circulating leukocytes following major blunt trauma [Brandfellner et al. DOI: 10.1097/SHK.0b013e31829de02f].