Basic Information

Symbol
CYP27A1
RNA class
mRNA
Alias
Cytochrome P450 Family 27 Subfamily A Member 1 CYP27 CP27 CTX Cytochrome P450, Subfamily XXVIIA (Steroid 27-Hydroxylase, Cerebrotendinous Xanthomatosis), Polypeptide 1 Cytochrome P450, Family 27, Subfamily A, Polypeptide 1 Sterol 26-Hydroxylase, Mitochondrial Vitamin D(3) 25-Hydroxylase Cytochrome P-450C27/25 Sterol 27-Hydroxylase Cytochrome P450 27 5-Beta-Cholestane-3-Alpha, 7-Alpha, 12-Alpha-Triol 26-Hydroxylase 5-Beta-Cholestane-3-Alpha, 7-Alpha, 12-Alpha-Triol 27-Hydroxylase 5-Beta-Cholestane-3-Alpha,7-Alpha,12-Alpha-Triol 26-Hydroxylase Cholestanetriol 26-Monooxygenase Cerebrotendinous Xanthomatosis EC 1.14.15.15
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis

MANE select

Transcript ID
NM_000784.4
Sequence length
1895.0 nt
GC content
0.5826

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-768.30 kcal/mol
Thermodynamic ensemble
Free energy: -801.80 kcal/mol
Frequency: 0.0000
Diversity: 406.90
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((...((((((.(((((.(((.((.....)))))))))..).))))))....((((((.(((((..((.(((((((((((.((((.((((((((...)))).)))))))).))))).).))))))))))))...)))))).....(((.((((((((((((....))))...))).))))).)))(((...(((((((....))).))))..))).((((((((...(((((((((...((((.(((((((..(((...))).....((((..((((...((.((((......((((((((((.((((((...))))...)))))))..))))).....)))).))...)))).))))((((...(((((..(((.....)))..)))))))))..((((...)))).))))))...).))))..))))))))).((((((.(((((((...........((((.((((((...((((((..(((.(((((..(((..((.....)).))).))))).))).((((....))))(((((((.((.......))..))))))).(((((((........))))))).....((.((((...(((((((((((..((((((((...((((.((((((.(.(.((((((....(((....(......)....))))))))).).).))).)))))))..)))..)))))..)))))))))))..))))))((((((((.....((((....))))..))).)))))..........(((......)))......)))))).......))))))..)))))))))))...))))))..((((((....((((((......))))))((((((....))))))((((((..(..(((..(((((((((((((((((((.....(.((((((...(((((((((.(.....).)))))))))..)))).)).).....))))(((((..(((((((..((((((.((((((((((((((.....).)))))))))))))((..(((.(((.(((((((.(.((((....(((........)))((((...((((.(((((.....)))).).))))....)))).)))))))))))).)))))).))((((....)))).((((((..(.(((((..((........))..))))))))))))...((((((.....))))))...(((((((((............)))))))))...............(((.((((((((((((.(((.(((((((.......)))))))........((((.(((....))).))))..((((.(((((((.((..(((..((((....(((((((...((((..(((((((((((((....(((((((...((..((((...(((((..((((((((.((.(((((((.(((((.((((..((..(.(((((((...((.((((.........))))..))...)).))))).)..))...))))))))).))))))).)).)))))).))...)))))))))...))...)))))))..((((.........)))).((((((...)))))))).))).)))).))))..)))).(((..((((((((((.......))))))))))...))).)))))))..))))..)))..)).).)))))).)))).))).))).))))))))).))).))))))..(((.((((....)))).))).....)))))))....)))))))))).))))))))))..))).)..))))))..((((.....))))))))))...)))))))))))))..((((..((((((((....))))))))..))))...
Thermodynamic Ensemble Prediction
..,{.(((((,..((((((.({{(({(((.((.....)))))})))..).)))))),,{({{{{((.(((((..((.(((((((((((.((({,((((((((...)))),}))))))).))))).).)))))))))))).,,))))||.|..{{||.{{.((((({(((..((((,(({.,,.,,)))))..)))}..}))))))},{,||,,.,,}}.,}))}{(((((((...(((((((((...((((.(((((((..(((...)}).,{{.{(((..(((({{.((.((((.{{...((((((((((.{(((({...})))}..},)))))..)))))..}}.)))).)),}.)))).)))|||{(,.,(((((..(((.....)))..))))))))},.((((...)))).))))))...).))))..))))))))).((((((.(((((((...........((((.((((((...((,((({.(((.(((((..{((,,{{....,)).}}).))))).))).((((....))))(((((((.({.......}),.))))))).{((((((......,.))))))).....{{.((((.,.(((((((((((..((((((((...((({,((((((.(.(.((((((....,{,...........}...,))))))))).).).))).)))))))..))}..)))))..))))))))))),.))))}}((((((((.....((((....)))),.))).))))).....,....{{{......)),......}}})))).),...))))))..)))))))))))...))))))..(((((,...{((((((......))))))|(((((....))))),((((((..(..(((..(((((((((((((((((((.....{.(((,,({{{(((((((((.(.....).)))))))),.})))).)).}.....))))(((((..((((((({{(((((((((((((((((((({.....}.)))))))))))).((..(((.(((.(((((({.(,((((....{((........))}((((...((((.(((((.....)))).).))))....)))).,))),))))))).)))))).))((((....)))).(((((,.{{.(((((..(({.....,.})..))))))))))))...((((((.....))))))...,(((((,,,}}}}}..}}}}})},,,,,.,....}},..{{(,,((({.(((((((((((({(((.(((((((.......))))))),,{,,...||||,{{{..,,|||.}|}},,((((.((((((({({..(((..((((,.{{({.(((((({(,,,..||||||||(((({.,,{(({((,{{({{,.,(({...((({{{,,|||...,))}..|||||||||||,|,||||}}}|,,|||{{{{{(||{(({({{{...|}||}.|}||,.}}.,|}},,,,||||.,,|,|..}))))))))))|||||....))))),,}}.,..,,,,,.(((((((.{{.{..{((...))}.....},.))))))){||{{...))))}|||,|||,}},}.)))}.,)))).|||..|{{||||{{{.......))))))))))...))),,,)))),..)))),.)}).,)).}.|}}}}}.)))).))).))),})))))))).}})}))))),.,(((.((((....)))).))).,...)))))))....)))))))))).))))))))))..))).}..)))))).,((((.....))))))))))...))))))))))))).}|(((..((((((({....})))))))..)))}...

Transcripts

ID Sequence Length GC content
ACUCGACCCAAAGGUGCAGGCGCGCGAGCACAACCCAUGGCUGCGCUGG… 1895 nt 0.5826
Summary

This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein oxidizes cholesterol intermediates as part of the bile synthesis pathway. Since the conversion of cholesterol to bile acids is the major route for removing cholesterol from the body, this protein is important for overall cholesterol homeostasis. Mutations in this gene cause cerebrotendinous xanthomatosis, a rare autosomal recessive lipid storage disease. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the CYP27A1 is significantly upregulated in blood samples from acute myocardial infarction patients and validated as a diagnostic biomarker with an AUC of 0.771 [Xu et al. DOI: 10.1097/MD.0000000000045611]. In contrast, a separate investigation in humans found that the CYP27A1 was among the top ten down-regulated genes in circulating leukocytes following major blunt trauma [Brandfellner et al. DOI: 10.1097/SHK.0b013e31829de02f].