Basic Information

Symbol
CYP2A6
RNA class
mRNA
Alias
Cytochrome P450 Family 2 Subfamily A Member 6 CYP2A3 CYP2A CPA6 Cytochrome P450, Subfamily IIA (Phenobarbital-Inducible), Polypeptide 6 Cytochrome P450, Family 2, Subfamily A, Polypeptide 6 1,4-Cineole 2-Exo-Monooxygenase Coumarin 7-Hydroxylase Cytochrome P450 IIA3 Cytochrome P450 2A6 Cytochrome P450(I) CYPIIA6 Flavoprotein-Linked Monooxygenase Xenobiotic Monooxygenase EC 1.14.14.- EC 1.14.14.1 P450C2A P450PB
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Individual identification

MANE select

Transcript ID
NM_000762.6
Sequence length
1761.0 nt
GC content
0.5662

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-674.7 kcal/mol
Thermodynamic ensemble
Free energy: -707.05 kcal/mol
Frequency: 0.0000
Diversity: 490.77
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.(((((((.......((((.((((((..(((((((((((.((((.(((((((..(((..(((.(((((((((.(.....).)))))..))))))).)))..)))))))(((.((((((((((((.....)))(((((..((((((.(((...(((((((..(((....))).))))..)))....)))...))))))..))))).(((((.((((((.((.((((......((((((((((...(((((..(((((((((..(((.(.((.((((.(((((((((.((..((((((((((..(((((((.(((.(((((.((.(((.(((((.(((((..((((((........(((.(((((((.(.(((......))).).)))))))))).(((((((.(((((.(.....((((((((........))))))))....).))))).))..)))))..))))))..)))))..))))).))).))..)))))....(((..((((((((((...........((((((((((...((((.((...((((((((.(.((..........)).).))))))))..(((((.((....)).)))))....(((((....((((.((.(((.(((.(((....))))))))).))))))....))))))).))))...((((...))))...(((.(((((...(((.((((..((.(((((((.(......).)))))))...)).)))))))..))))).)))))))))))))..........)))).))))))..)))...((((...)))).....)))))))))).(((.(((.......))).)))(((.(((((.((.....)).))))).)))......)))))).....))))...)).)))))...)))).)))).)).).))).)))))))))))))).....((.(((((((((.((((...((..(((....)))..))(((..(((....)))..))).....)))).))))))))))))))..))))))).)))).)).)))))))).))).......)))))))))..)))..(((((((..((((((((.....((.(((...(((.((((.....)))).)))....)))))))))))))..))))))).....(((...)))))))))))))).))))..((((((((((......))))..)))))).((((((((........(((......)))((.((..((((.((.((.(((((((((....(((..........)))...))))))))).)))))))).)))).........))))))))...)))))).))))((((((((((((((((.....(((((((((....((((((((((..(.((.(((((((.(((..((((((....))))))(((((.(.((..(((((((((.(..((((..(((.((........)).)))..((((((((..((.(((.((((......)))).))).)).))))))))..))))..)))))))))).....)).).)))))..)))(((...)))..))))))))))..)).))))).)))......))))))))).....))))))))))).....((((((.((....(((...)))..)).)))))).))))))))))))..)))((((((...........((((((..............)))))).......))))))..
Thermodynamic Ensemble Prediction
.,({.(((((((.......((((.((((((..(((((((((((.((((,(((((({{((((,,,{({{{{..,{{{.{,,,.{|{|||||,|||}||||,{({{{|{|||{((({.({(((({{{{|{.....)))|{|||,.{|{{{{.(({...{{{((((..(((....))).))))..))}....}))...)})}))..))))),{{({{.((((((.((,((({......((((((({{{,.,(((((..(((((((((..(((.(.((.((((.(((((((((.((,{(({{((((((,,((({{{{||||,(((((.((.(((.(((((.(((((..(((((({,....,,(((.(((((((.{.(((......))}.}.)))))))})).{{{{{,(,(((((,(...,,((((((((........))))))))....}.))})).}},,))))))}}}))))..)))))..))))).))).))..)))))...{(((..((((((((((.......,.{,{{((((((({,,,{{{{.({...((((((((.(.((..........)).).)))))))).,|{{{{.{{...,)).}}}||,|{{(((((....((((,({.(((.(((.(((....))))))))),)}))))....)))))}}.)))),..((({...})))...(((.{((((...(((.((((..((.(((((((.(,....,).)))))))...)).)))))))..))))).)))})))))))))},........)))).)))))).,)))...((((...)))).....,}}}||||||{(((,({{...,,..)))})))|{|.(((((,({.....)).))))).}}}......})))))....,)))}...)).))))),..}))).)))).)).).))).)))))))))))))),{...((.(((((((((.((((...((..(((....)))..))(((..(((....)))..))).....)))).)))))))))))))}..))))))).)))),)),)))))),}.}|},,,....|||||}||}.,|||.{((((((({,,,,,||||,...{((.(((...(((.((((.....)))).)))....))))))}}})))),|))))),),.}}))},..)))}))))))))))).))))..((((((,(((.,....),)),.)))))).{(((((((........(((......})){{.((..((((.(,{((.(((((((((....,{{{({,,,...,)))},.))))))))).)))))))).)))}....,.,..)))))))}...)))))).}))),((((((((((((((((.((((({,{,({(....((((((((((..(.((.(((((((......((((((....)))))){(((,...,,}}|(((,((((.(..((((,.,,..,,......,,,},|||{{((((((((.,{(.(((.((((......)))).))).)).)))))))).,))))..}}})}}||||.....,}}}})))))}..}.|||}.})),..))))))))))..)).))))))}})......)))))))))...)}))))))))))}....,|{|||({(((.{..(({{{|,..,))})),,,).)))))))))))).||||((({{,..,,..,{{..{{{{{{.,,,,||.||....}}.}},},,,}}.})))))..

Transcripts

ID Sequence Length GC content
AUCUAUCAUCCCACUACCACCAUGCUGGCCUCAGGGAUGCUUCUGGUGG… 1761 nt 0.5662
Summary

This gene, CYP2A6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to hydroxylate coumarin, and also metabolizes nicotine, aflatoxin B1, nitrosamines, and some pharmaceuticals. Individuals with certain allelic variants are said to have a poor metabolizer phenotype, meaning they do not efficiently metabolize coumarin or nicotine. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. The gene was formerly referred to as CYP2A3; however, it has been renamed CYP2A6. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the CYP2A6 is a vaginal secretion-specific mRNA marker used for body fluid identification and individualization within a validated dual-function MPS panel, where it functioned as a cSNP marker (rs1137115) and produced a DNA product at high DNA input [Liu et al. DOI:10.1007/s00414-025-03434-0]. A review of forensic transcriptomics further lists the CYP2A6 as a validated mRNA marker for vaginal secretion identification [Lei et al. DOI:10.1093/gpbjnl/qzag007].