| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCUGUCAUCUCACUACCACCAUGCUGGCCUCAGGGCUGCUUCUGGUGG… | 1760 nt | 0.5631 | |
| AUCUGUCAUCUCACUACCACCAUGCUGGCCUCAGGGCUGCUUCUGGUGG… | 1607 nt | 0.5576 |
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum; its substrate has not yet been determined. This gene, which produces two transcript variants, is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the CYP2A7 is a vaginal secretion-specific coding region SNP (cSNP) targeted in a massively parallel sequencing assay for body fluid identification and donor attribution [Trnka et al. DOI:10.1016/J.Fsigen.2026.103455]. In an evaluation of mixed biological stains, the CYP2A7 was part of a panel of three cSNPs for vaginal secretion, though this fluid exhibited the lowest estimated read counts and highest variation, leading to frequent allelic dropout and poor discrimination power in mixtures [Dørum et al. DOI:10.1016/j.fsigen.2022.102685].