| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCCCGGGCUGGCAGCAGGGCCCCAGCGGCACCAUGUCUGCCCUCGGAG… | 1674 nt | 0.5125 |
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that major blunt trauma triggers a selective upregulation of oxidative enzyme transcripts in circulating leukocytes, where the CYP2E1 was significantly changed from control and its expression level correlated with the Injury Severity Score [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f]. In a separate investigation using a rat model of pulmonary arterial hypertension-induced right ventricular failure, RNA sequencing revealed the CYP2E1 was downregulated -3.8-fold in the right ventricle, and its inhibition is associated with increased oxidative stress [Potus et al. DOI:10.3390/ijms19092730]. A study in mice demonstrated that the CYP2E1 is one of five commonly used reference genes studied in tissues for post-mortem interval estimation [Scrivano et al. DOI:10.1007/s00414-019-02125-x].