Basic Information

Symbol
CYP2E1
RNA class
mRNA
Alias
Cytochrome P450 Family 2 Subfamily E Member 1 CYP2E Cytochrome P450, Subfamily IIE (Ethanol-Inducible), Polypeptide 1 Cytochrome P450, Family 2, Subfamily E, Polypeptide 1 4-Nitrophenol 2-Hydroxylase Cytochrome P450 2E1 Cytochrome P450-J EC 1.14.14.1 CYPIIE1 Flavoprotein-Linked Monooxygenase Microsomal Monooxygenase Xenobiotic Monooxygenase EC 1.14.13.N7 P450C2E P450-J CPE1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Sudden death from respiratory system disease Postmortem interval inference

MANE select

Transcript ID
NM_000773.4
Sequence length
1674.0 nt
GC content
0.5125

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-540.40 kcal/mol
Thermodynamic ensemble
Free energy: -574.07 kcal/mol
Frequency: 0.0000
Diversity: 538.40
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((.((((...(((((.....))).)).)))).))))..(((((((.(((((.......(((.((((.(((.((((..((((((.(((((.(((....))))).)))))))))..))))...))))))).))).((((((.(.((((((..((.(((...((((((((.(((.((((((((..((((((..((((((...((....)).((((((((.((((((.((((.((...)).)))).)))))).))))).)))..(((.((((.((....((.((((.(.(((..((.(((((.((..((........))..)).)))))..))..))).))))).)))).)))))))))))))..))))))..)))))))).......))).))))))))......((.((((......)))).)).))).))...)))))).)))))))..((((((((((((..((.((.(((((..((((..(((((((.((....))..)))))))......))))..))))).)).))..(((((....((((((((((((.(((((..(((....((....(((..((((((.((((................(((((..((.((((((((..((..........((((............))))..........))..)))))))).))...)))))....(((((.(((((((((..((...(((((((................)))))))..)).....))))).))))..)))))(((((.((...........((((.((((.......))))..))))))))))).......)))).))))))..)))...))....).))..))))).)))).............(((((...)))))....)))))))).((((((((...))))))))......((((((((((((.(((..(((((((.((((.(((((((...((((((........))...(((((((((.((.......(((((..(((.(((...))).))))))))((.....))...((((.....)))))).)))))).)))..))))))))))).)))).)))))))....)))(((((((......(((........)))....((((......)))).((((...)))).......)))))))((((..(((....)))...)))).((((......))))............(((...)))....((((......))))..((((((...((((((((........(((......)))........))))))))..))))))...)))).)))))))).)))))..((((.((((.((((......))))...)))).))))....((..((........))..))))))))))).)))...((((((.(.((..(((((..........))))).))).))))))..)))))...........(((((.((((.(((........))).)))))))))(((((.((........((((((((.........)))))))))))))))...........)))))))..........(((..((((((((((((....))))))...))))))..)))((((((...))))))............
Thermodynamic Ensemble Prediction
.....(((((({((((((((((...({((,....,{.{{,|,...)}}}.},)))}))))))))))(((((((((((((({{(((.((((((((({.{((((.((((((({{{{,||{((,(({{,,,(((,,,,}||,,,||||,}||((((,....,}||},..{(((((((.,((.((((((((..((((((..((((((,,,{.....|{(((,(((((.((((((.({((.({,..,}.}))).)))))).))))).|||||(({.{{{{.{(,,,.{(.((((.(.{((..((.(((((.((..((........))..)).)))))..))..)))}|)))).)}}).))))),}})))))..)))))).,)))))}}}.,,,..}},,.)))))))|...{(((({,,{(,.{{{{|,,,.||{{||.}.....},))).)))},..})))),,,.||,.|}}||}|{,{((((,{(({{..{{{{{{{,||,...,.,.}}))}}}......}}}}..)))},.},.....,}}}}}}}.{(((((({((({.{{{{{.,|{|.,,,||,.,.{{(..((((((.((((..,{{....,,,.|,,{{(({{,{{.((((((((..((....,.....((((..........,.}))},,,,......||,.}}}}}}}}......,}}}},,..(((((.(((((((((..,{,..(((((((................)))))))..}},....))))).))))..)))))||{|,{((,,|.||,,...((((,(({{.....,,||||,{|||,,,,},)),....,,}}}}.)}))}}..)))}..))....|.|}.,)))||.)))),,{..{{{{....(((((...)))))...})))}}))},|||||||,,}}))))}))),,..,,)))}}.....{{{||||,||||||||||((.(((((.(......}.)))))}},.,},}.|||{||||{.{{....,,.{(((({(((({((({..||}{||||||||(({{{...},}.||||....,|||}||,||,|},.})))})}.}))}||)),)).),}))))}}}))))),)))).,....}))}))}}))},..,,.....}.)})))))..,,,.((((...))))..|{...,|}(((((.((((.{{....,,{(((({,{{{{{{,{,...,}}}....}|}.....,,},)))))}...{{{{...,..))}}..((((((...((((((((........(((......)))........))))))))..)))))).)))).)))))}),))))))))))..)))))))).(((..(((((...,{,,((({{{......)))}))}....,...)))))..)))(((((,(,...))...))))).,))))))......,,..(((((((,.{({........}}}...)))))}}.(((((.{(((.(((.....,},)}).)))))))))(((({,{{........((((((((.........)))))))))))))))......,,....||......,,..,,...,,||||{{{{{{{{{|..,,))))}}..,)}}}}}{(({,((((((...))))))}})}........

Transcripts

ID Sequence Length GC content
CUCCCGGGCUGGCAGCAGGGCCCCAGCGGCACCAUGUCUGCCCUCGGAG… 1674 nt 0.5125
Summary

This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that major blunt trauma triggers a selective upregulation of oxidative enzyme transcripts in circulating leukocytes, where the CYP2E1 was significantly changed from control and its expression level correlated with the Injury Severity Score [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f]. In a separate investigation using a rat model of pulmonary arterial hypertension-induced right ventricular failure, RNA sequencing revealed the CYP2E1 was downregulated -3.8-fold in the right ventricle, and its inhibition is associated with increased oxidative stress [Potus et al. DOI:10.3390/ijms19092730]. A study in mice demonstrated that the CYP2E1 is one of five commonly used reference genes studied in tissues for post-mortem interval estimation [Scrivano et al. DOI:10.1007/s00414-019-02125-x].