| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGAAGAGCAGGAGGACGUCUGAGCCAUGCUCGCGGCGAUGGGCUCUC… | 1879 nt | 0.4683 |
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is thought to be the predominant enzyme responsible for epoxidation of endogenous arachidonic acid in cardiac tissue. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
A study in human patients with ischemic cardiomyopathy (ICM) identified the CYP2J2 as a druggable gene upregulated in all three end-stage cardiomyopathies (ICM, hypertrophic, and dilated) compared to non-failing controls, suggesting a common transcriptional profile and a potential compensatory role in heart disease [Simonson et al. DOI:10.1016/j.celrep.2023.112086].