Basic Information

Symbol
CYP7A1
RNA class
mRNA
Alias
Cytochrome P450 Family 7 Subfamily A Member 1 CYP7 Cytochrome P450, Family 7, Subfamily A, Polypeptide 1 24-Hydroxycholesterol 7-Alpha-Hydroxylase Cholesterol 7-Alpha-Monooxygenase Cholesterol 7-Alpha-Hydroxylase Cytochrome P450 7A1 CYPVII Cytochrome P450, Subfamily VIIA (Cholesterol 7 Alpha-Monooxygenase), Polypeptide 1 Cytochrome P450, Subfamily VIIA Polypeptide 1 Cholesterol 7 Alpha-Monooxygenase Cholesterol 7alpha-Hydroxylase Cholesterol 7α-Hydroxylase EC 1.14.14.26 EC 1.14.14.23 EC 1.14.13.17 EC 1.14.13 CP7A
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_000780.4
Sequence length
2877.0 nt
GC content
0.3837

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-748.84 kcal/mol
Thermodynamic ensemble
Free energy: -801.28 kcal/mol
Frequency: 0.0000
Diversity: 605.59
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((..(((.(((.((((((((((((((((((((..(((((((...((((((((((((.(((....((((....)))).(((((((.((((((.((((((((((((...))))).)))))))..)))))).)))))))(((..(((....(((((...)))))((((.(.(((((.....))))).))))))))...))))))))))))).)))))..))).))))(((((..((.....))..)))))..((((.(((((((((.((...........))))))))))).)))).....(((((...((((((......))))))..)))))....))))))).)))))))))))))........((((((.......))))))....(((((((.........)).))))).))).)))....)))))......................(((((((((....)))((.(((((((..((((.....))))...(((.((((.....)))).))).....(((((.....)))))..........((((.(.(((((.(((((.(((((((((....))))))))).((((.(((..........))).))))......)))))..))))).).)))).)))))))))..((((((((.(((((((((........(((((....((((((((............((((((((((((.((((((((.(((...(((....)))...))).))))......)))).))).....)))).)))))))))))))..))))).((((.....))))(((((((((.(((...........))).).)))))).))...(((((((.(((.(((((.((((.(((((((..(((((.((......)).))))))))))))))))(((((((....((((.((((.((((((((((.((((...((....))....)))))))))((((((((.((.((((((((((((((((((((......((((((..((.(((((...((((.((((((.((((((......))))))...)))))).).)))...))))).)).......(((((((.......((((((((..(((((........)))))((((((.....((...((.(((((.....)).))).)).)))))))).))))))))....((((......)))).(((..(((((..........))))))))....(((((......))))).((.(((.....((.((((....(((((((((......(((((...(((((((..(((((((((((.((.(((...(((.(((((.(((.............((((((((((((((((.((((((..(((((.(((((((((((((.......)))......)))))))).(((((.((((......))))..))))).((((((.....(((((((((((..(.(((..((((((.((..((.((((..((((.((((.(((((((((((((((((....(((((((((....)))))))))((((((((........(((((......((((................................))))......))))).......))))))))))))))))))))))))).....(((((((....((((((((((((.(((....))).))))))...)))))))))))))..(((((.(((.((((((((((......)).)))).......)))).))).))))).........(((((((((((.....(((((.((..(((....)))..)).)))))((((........))))(((((......)))))................)))))))))))...........(((((((........)))))))..)))).)))).)))).))))))))))..))).).))))))).))))..))))))........)).)))))..)).)).)).)))))..((((((((...(((((...(((((((((.(((...(((((....(((((......))))).......)))))...))).)))))).)))...)))))....(((((......)))))(((.(((((((((.....))))))))).)))))))))))((((((.....))))))(((((((((((..(((((((....)))))))..(((((....)))))))))))))))).............)))))).....)))))...........))).)))))..))).....))).))))))))))))).))))))))))))......))))))))).....)))).))...))).)).....)))))))))))))..)))))))))).)))..(((..((((((.....))))))..))).......)))))))...)).))))))))......((((.(((((..((((........))))..)))))))))....)))))....))))))))...((((.((..(((((((((((..(((((((((((.((((((((...))))).))).)))...))))))))))))).)))))).)).))))..)).)))))..............))))))))..)))))))..)))).)))))......((((((.((........)).))))))(((((...))))).(((((....))))))))))))).(((..((((.......))))..)))................(((((.(((.(((....)))))).)))))....))))))...(((((((((((........)))).)))))))..
Thermodynamic Ensemble Prediction
(((((..(((.(((.((((((((((((((((((((..(((((((...(((((((((({{((((....((((....}))},{((((((.((((((.((((((((((({...})))).)))))))..)))))).))))))}||{..{{{....(((((...)))))((((.(.(((((.....))))).)))))}}}...))))))))))))).)))))..)))}})))(((((..((.....))..)))))..((((.(((((((((.((...........))))))))))).)))).....(((((.,.((((((......)))))).})))))....))))))).)))))))))))))........((((((.......))))))....((((({{,,,......}).))))).))).)))....))))).................,|||,(((((,(((....)))((.{((((((..((((.....)))}...(((,((((.....)))).}}}.,,,.(((((.....)))))..........((((.(.(((((.,((((.(((((((((....))))))))).||||.|{{..,....,,,}}}.}}}}......)))))..))))).).)))).)))))))))..((((((((,{{{{{,,,,........(((((....((((((((..{{{..,..,{({(((((,((,,{({{.((((.(((...(((....)))...))).))))...},.,)),.}))}}}.,))}}.,))),))))))))..))))}.((((.....)))){{{((((((.(((..,,....,,.))).).)))))),}}...(((((((.((|{(((((.((((.(((((((..(((((.((......)).))))))))))))))))(((((({....(((,{((((.((((((((((.((((...((....))....))))))))){(((((((.((.((((((((((((((((((((......(((((({,(({(((((...((((.((((((.((((((......))))))...)))))).),,))...))))).}),}},,,.(((((((.......((((((((..(((((........)))))((((((.....((...((.{((((,....)).))}.)).)))))))).))))))))....((((......)))).,,,..{{{{{..........||||||,}....(((((......))))).,{,{{,...,}||.|,{{,...(((((((((......(((((...(((((((..(((((((((((.{{.(((..,(((.(((((.{({.,{,.........((((((((((((((((.((((,,..(((((.(({{({,,,,||({.,{{,,,{|{{(((({.....))))))}|,|||||.,{{,,,,,,,||,,,,((((({.....(((((((((((..,.(((..((((((.{({(((((.(((.((({{{((({{{{(((((((((((((({...(((((((((....))))))))){(({((((,,,,,,,,(((((......({((...,|,,,{{.,.,,.,,,|,,||........}}}}......)))))|....,.))}}))))))))))))))))))|||||,..{{({(({|...{(((((((((((.(((....))).)))))}..,))))))})))))|.,||},|....,||||||||,{.{({{((((((,,.....}}}}}}..,,.)|||.{{{{....}))),})),}}|}}...}}||||||,.|||}}},,..))).))))))|{{{........}}}}|{(((......))))},,,{{,{{{{..,,,}))))))))},.,,||||......,||})}}|||||,|||,,}}||,||}}..)))}),,,,}.))))))))..))).|.})))))).))))..}})))),,,.,},.)).)))))..,}.))}}).)))))..{(((((((...(({{{...{{{{((((({(((...((,,({{{{.,,}})}}..,}|||{,....}}))),)}}}),}.}))))}.))}...})))),...{((((......))))}(((.(((((((((.....))))))))).))))))))))}.,(((({{{{.{{{||...,((,,,.}|..}}}}}}}}}}})},,,||.,(((({....}))))||||,,,,}})}............)))))).....)))))........,..))).)))))..}}),,...))).}}))))))))))).))))))))))))......))))))))).{{||,,,{,.....))}}))}....)))))))))))))..)))))))))).)))..{((..((((((,...,))))))..))).......}))))))...)).)))))))}......(((,{(((((..((((........))))..)))))))))....}))))....))))))))...((((.{,..(((((({(({,..(((((((((((.((((((((...))))},))).)))...)))))))),}})).)))))).}}.))))..}).))))).,.,..........))))))))..))))))),.,}}},}}}}}......((((((.((,.....,,)}.))))))(((({...})))).{((((....))))))))))))).(((..((((.......))))..))).............,,,(((((.{(,{(({....})))}}.))))).,,,,}))))...(((((((((((........)))).)))))))..

Transcripts

ID Sequence Length GC content
AGUGGCAUCCUUCCCUUUCUAAUCAGAGAUUUUCUUCCUCAGAGAUUUU… 2877 nt 0.3837
Summary

This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway in the liver, which converts cholesterol to bile acids. This reaction is the rate limiting step and the major site of regulation of bile acid synthesis, which is the primary mechanism for the removal of cholesterol from the body. Polymorphisms in the promoter of this gene are associated with defects in bile acid synthesis. [provided by RefSeq, Feb 2010]

Forensic Context

A study in porcine (Sus scrofa) skin exposed to bromine vapor demonstrated that the CYP7A1 gene, encoding cholesterol 7α-hydroxylase, was significantly decreased approximately 3.4-fold in both 10-minute and 20-minute exposure groups at 48 hours post-exposure, as identified via microarray analysis [Rogers et al. DOI:10.1002/jbt.20383]. This transcriptional downregulation was part of a common set of significantly altered signaling pathways, with a minimum of 83% similarity in modulated probe sets between exposure durations.