| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCCCAGCCAUGCCCGCCCUCAGUCGCUGGGCCAGCCUGCCCGGCCCCA… | 2745 nt | 0.6149 |
The protein encoded by this gene is an oxidoreductase belonging to the copper type II, ascorbate-dependent monooxygenase family. The encoded protein, expressed in neuroscretory vesicles and chromaffin granules of the adrenal medulla, catalyzes the conversion of dopamine to norepinephrine, which functions as both a hormone and as the main neurotransmitter of the sympathetic nervous system. The enzyme encoded by this gene exists exists in both soluble and membrane-bound forms, depending on the absence or presence, respectively, of a signal peptide. Mutations in this gene cause dopamine beta-hydroxylate deficiency in human patients, characterized by deficits in autonomic and cardiovascular function, including hypotension and ptosis. Polymorphisms in this gene may play a role in a variety of psychiatric disorders. [provided by RefSeq, Aug 2017]
A study in mice demonstrated that prenatal psychostimulant exposure permanently impairs glucose homeostasis by reducing pancreatic beta cell insulin and serotonin content, with the DBH mRNA expressed in human fetal pancreas and infrequently in human pancreatic beta/alpha cells [Korchynska et al. DOI:10.15252/embj.2018100882]. A systematic review of human cadavers found that the DBH protein shows a reduction in immunohistochemical expression in heart tissue starting from 4 days post-mortem, with an absence of detection from 8 days, providing information for post-mortem interval estimation [Salerno et al. DOI:10.3390/diagnostics12092114].