Basic Information

Symbol
ADRA2A
RNA class
mRNA
Alias
Adrenoceptor Alpha 2A ADRAR ADRA2R Alpha-2 Adrenergic Receptor Subtype C10 Adrenergic, Alpha-2A-, Receptor Alpha-2A Adrenergic Receptor Alpha-2A Adrenoreceptor Alpha-2AAR Subtype C10 Alpha-2A Adrenoceptor ADRA2 Alpha-2-Adrenergic Receptor, Platelet Type Alpha-2A-Adrenergic Receptor Alpha-2AAR ALPHA2AAR FPLD8 ZNF32
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000681.4
Sequence length
3879.0 nt
GC content
0.5971

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1601.40 kcal/mol
Thermodynamic ensemble
Free energy: -1664.11 kcal/mol
Frequency: 0.0000
Diversity: 962.23
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((....)))...))))(((((((((((((.((.(((((((((.((((....(((..((((.(((((((((((((((((((((((....))........(((((((.(((((...))))).......)))))))(((((((((....(((....)))((((......)))).((((((((((((((.....)))))((....)).....(((((((((((.((((((..((((.(((.......)))))))....))))))....((((((((((((((((..((((((((....((((((((..((....)).)))))))).....))).)).)))((((((....((((((((((.((((((((.(((((.(((((((..((((..((((.((((((..((.(((((......)))))..))))))....(((.(((((((((..(....)..)))).....))))))))..((....)).....)))))))))))))))))))))))))))).((.((((((((..((((((..((((((((((.(((((..(((.((.((((((((.((((((((((....))))).))))).).)))).)))...(((((((....((.....((.((..((((((((.(......).))))))))..)))).....))..((((.................))))...........))))))).)).)))..)))))..))))..))))))(((...((((((((((((..((....)))))))))......((((.(((((((...((((((....))))))....)))))))))))((((..(((((((.(.(.......).).)))))))..))))(((((((.(((((((((((((((..(.((....)))((((((((((..((((((..(.((((((((..((((((.(.(((((.(((((..((((((....)))))).((((.((((((((....))))).))).))))(((((((((((((((.((((.....))))..))))....((.(((.(((((((.....)))))))))).))............))))))).)).)).))))).))))).))))))))))))))))..))))))..))).)))))))..((.((((((...(((....)))...)))))))).(((((...))))).......)))))))))((((((...(((....))))))))))))))).)).)))))..........)))))..)))....))))))((((.((..((((....((((..(((..((((((.((......(((....((((((((......)))))))).))))).)))))).((((((........((((((......)))))).....((((.............))))..)))))))))..)))).)))))).)))).......)))))))))).....)).)))))).)))).....))))))((.((((....)))).)).))))))))))))))))((((.((.(((.(.(((((((.(((((((..(((((((....)))).))).))))))).))))..((((((((..((((((((((((((......((((.((((..............)))))))).(((.((((((....((((((...(((.(((((((((((((((..(((((.(((((((...(((......))).)))).)))...))))))))))))))).))...((((((((((.((((((......((((....((((......))))....)))))))))).).).)))))))).))).))).))))))....))))))..))).((((((((...(((((.(..........).)))))..))))))))((((((..(((((....).))))..))))))..)))).)))...)))))))..)))...))))))))..).))).)).)))).))))))))))))))))))))...))).))))))..)))))).))))))))))).)))).))))..)))..)))).)))))))))))))))(((.((((((.((((((........(..(((((((((((.((.((((.((..((.(((((((((..(((..............)))..))))).))))))..)).)))))).)).)))).)))))..)........)))))).)))))).))).........(((((((.......(((.....(((((((........((........))...(((.(((.((.(((..((((((((((((((...((((.(((((((((.(((.(((.((...))))).)))))))))).)))))).((((..(((((((.(((((((.((....(((....)))..........(((((((.(((((.....(((...........((((((((.((((((....))))))((((....)))).(((((..((((((.(((.....)))((((((((.((((.......).))).))))))))..))))))....)))))......((....))))))))))..........))).......))))).............)))))))..)).)))))...((((....)))).(((((((((....((((((..((((.......((..((((((.((((((((((.......)).))).))))).)))))).))...((((((((((((....)))).........(((((((......)))))))((((((.....((((((((((.....)))))...)))))....))))))..............((((..((((((......))))))..))))..)))))))).((((.((((((((......))))))))...))))..))))...((((...)))))))))))))))))))..)).)))))))..)))).......(((((((...))))))))))))))))))))).))).)).))).)))........(((((((((((((........)))))))))))))........(((....))).....................)))))))......))).......)))))))..))))))....((((((....(((........)))......)))))).((((.......)))).............)))........((((((((((....(((((((.(((((((.((...((((((((.........)))).))))....))..))).))))......(((((..(((....))).)))))...(((...(((....)))...)))......)))).)))...((((((((((..(((.....((((((((((((((((((..((((.(((((.........(((.....))).(((..((((((.(((....)))))))))..))).))))).))))..))))((((((((....((((...((((....((((......)))).....)))))))).))))).))))))))))....)))))))......))).))))))))))....(((.(.((((((....(((....((((((((((((((..............((((((((.....)))...)))))((((((((((((......)))))))))))).........)))))))).........))))))..))).)))))).)..)))(((((((.((....)).))))))).))))))).))).((((((((((((((((....)))))))).....)))))))).
Thermodynamic Ensemble Prediction
((((((({{..|||{,.||||((,((,{,.{{|{,(|.(((((((({.((((,,,,((({,((((.(((((((({,((((({{{((((({{,,,{{{,.....(((((((.(((((...))))).......))))))).{(((((((....(((,,.,}}}((((......)))).((((((((((((((.....))))}{{....}}.....(((((((((((.((((((.,((((,(((.....,.)))))))....))))))....((((((((((((((((,,((((((((...,(((((((({.((....)).)))}))))..,,.)))},),)))((((((....((((((((((.((((((((.(((({,(((((((..((((..((((.{,((((...,.(((((......)))))..,}))))....(({{(((((((((..(....)..)))).....))))))))..((....)).....,,)))))))})))))))))))))))))).((.((((((((..((((((..((((((((((.(((((..(({.{{.((((((({.((((((((((....)))))))}))).},}))).)))...(((((((,{{.({...},||}({..((((((((.,......).))))))))..}}...........|(({.................)))}.,.,,......})))))).}).}))..)))))..))))..))))))(,({{.((((((((((((..((....)))))))))......((((.(((((((...((((((....))))))....)))))))))))((((..(((((((.{.{.......).).)))))))..))))(((((((.(((((((((((((((.,{.{(...,||,((((((((((..((((((..(.((((((((..((((((.(.(((((.((((({,((((((....)))))).((((.((((((((....))))).))).))))(((((((((((((((.((((.....))))..))))...(((.(((.(((((((.....)))))))))).,}.,}}........))))))).)).))}))))).))))).))))))))))))))))..))))))..))).)))))))..((,((((((...(((....)))...)))))))),(((({...))))),}.....)))))))))((((((...(((....))))))))))))))).)).))))),.........))))).}))},...)))))){(((,((..{{((,,.,((({..(((,,((((({,(,.....,|,|,|,.((((((((......)))))))).,}}}},|||}}}.{|||||..,,,{,,(((((({....})))))}.....,})))}.,}},},,,...,}}}.||||}}}}},,))}}.}}}}}),))},.......))))))))))....,)).)))))).)))).....))))))((.((((....)))).)).)))))))))))))))){{((,((,(((.,.||||{||,||(((((..(((((((....)))).))).)))))||,||}}..((((((((..((((((((((((((.....,((({{((((....,.........))))))))}(((.((((((....((((((...(((.((((((((((((((({.,((((.(((((((,,,({{..,,,.))).)))).)))...))))))))))))))).))...((((((((((.(((((({{...,({{{....((((......))))....}})))))))).).).)))))))).))).))).))))))....))))))..))).((((((((...(((((.{..........}.)))))..))))))))((((((..(((({....,.))))..))))))..)))),,))...)))))))..)))...))))))))..,.))).)).)))),))))))))))))))))))))...))).)))))}}})),))))}))))})))))})))},))))..)}},})))),|||||}|||||}|||(({.((((((,({(({{,{,,,,..{..(((((((((((.((.((((.((..(,{(((((((((..(((..............)))..))))).))))))..)).)))))).)).)))).)))))..}.......,||||||.}|||}|{((,...{|...,}|{,((((((...(((.......}))...})))}}..,{......}|}}.}}|,,,|||,||,(((,{({{{{|||||||{|},}|||{.||{|||{,|||||,|||}{|}||},))),|}}),,||||.||.,|{{(((((((,,(((,,((..,(((({{{,.|||,,.|||}}},}.||..))),,,)))})))))))).)}))..,...},}}||||||||{{,((((.,..))))))||||}},.))))}||||{{,(({((({(((....,|||({{(((({.,,{{,...,,,|,||}.||||||||..|,,,||,{,{||||,.,.{{{{,..({(({{{|,|||{.....{{{.(((({.....,(((......,}}......||||||,..|}}},.....||{{...,)})),||||,|||,....,||||,.}}}|}}}}...,((,.((((((.((((({({{{,,,,...}),))),})))).)))))).,,...,,{{{{{{((({....,))).........(((((((,...,.)))))))((((((.....((((({((,(,....}}},}}}.)))))....))))))........,,,,..((((..((((((,....,))))))..))))..)))))))),((({.((((((((......))))))))...)))).,,}}}..,|{{{...)))})}}}},,,}))})}},,||||,..,||,.,|||,..},..{{{||||,,,))))))),}}|},},,))))).))).||.}}},}))...,,,..(((((((((((((........)))))))))))))}},,..,,|||....,))...,,,,}.}}}}....,{{{|||||||,{,,,,|||....,,.,||||||,,||,|}},,|,(({{{{...,|||,....,,,))),,,..,}))))},||{{.,|||..,})},.......................((((((((((....{((((((.(((((((.((..,((((((((.........)))).)))).,,.))..))).))))......(((({..(((....))).)))))...{({...{((....)))...))}......)))).))|{{.((((((((((..(((.....((((((((((((((((((..((((.(((((.........(((.....))).(((..((((((((({....)))))))))..))).))))}.))))..))))((((((((....((((...((((....{(((,.....}})),,.}.)))))))),))))).))))))))))....)))))))......))).)))))))))).}}|{((,(,((((({....{(({,..{(((((((((((((....{,........((((((((.....))),..}))))((((((((((((......)))))))))))).........)))))))).........))))))},))).)))))),}..}},(((((((.{{....}).))))))).))))))).)))......{(,((((((((....)))))))).},},}}})}}...

Transcripts

ID Sequence Length GC content
GAGCAGCAGCAGCUCCAGCUCGGUGCAGAAGCCCAGCAGCCGGCGUGCC… 3879 nt 0.5971
Summary

Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. The alpha-2-adrenergic receptors are a type of adrenergic receptors (for adrenaline or epinephrine), which inhibit adenylate cyclase. These receptors include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. They are involved in regulating the release of neurotransmitter molecules from sympathetic nerves and from adrenergic neurons in the central nervous system. The sympathetic nervous system regulates cardiovascular function by activating adrenergic receptors in the heart, blood vessels and kidney. Studies in mouse revealed that both the alpha2A and alpha2C receptor subtypes were required for presynaptic transmitter release from the sympathetic nervous system in the heart and from central noradrenergic neurons. The alpha-2-adrenergic receptors are also involved in catecholamine signaling by extracellular regulated protein kinase 1 and 2 (ERK1/2) pathways. A clear association between the alpha-2-adrenergic receptor and disease has not been yet established. [provided by RefSeq, Sep 2019]

Forensic Context

A study in humans demonstrated that the ADRA2A is specifically expressed in vascular smooth muscle cells and fibroblasts within the corpus cavernosum, with its expression upregulated in the myofibroblast cluster of patients with diabetes mellitus erectile dysfunction [Zhao et al. DOI:10.1038/s41467-022-31950-9]. Further research confirmed its distribution in the human vascular smooth muscle cell cluster and noted that its expression pattern is not cell-type-specific in rat corpus cavernosum [Yin et al. DOI:10.1016/j.celrep.2024.114760].