Basic Information

Symbol
DCHS1
RNA class
mRNA
Alias
Dachsous Cadherin-Related 1 FIB1 KIAA1773 PCDH16 CDHR6 CDH25 Cadherin-Related Family Member 6 Protein Dachsous Homolog 1 Protocadherin-16 Cadherin-19 Cadherin-25 FLJ11790 CDH19 Myxomatous Mitral Valve Prolapse 2 Fibroblast Cadherin FIB1 Dachsous 1 (Drosophila) Fibroblast Cadherin 1 Fibroblast Cadherin-1 Protocadherin 16 VMLDS1 MMVP2 MVP2
Location (GRCh38)
Forensic tag(s)
Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_003737.4
Sequence length
10713.0 nt
GC content
0.6186

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-4756.00 kcal/mol
Thermodynamic ensemble
Free energy: -4928.72 kcal/mol
Frequency: 0.0000
Diversity: 2439.28
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.((((((((((((..(.((((((((((...((..(((.(((((((.((((.((((.....))).).)))).))..))))))))...))....)))))))))).).)))))).))))))...((((((((.(((((.((((.(((.((((((...)))).(((((((((((((.(((((((((((((.(.((((.....).)))))))))....))))))...)).)))))).)))))))((((.(((((((((((((((((.(((.((((((.(((..((((((((.....)))..)))))..))))))))).).)).((((((((.((((.(((..........(((((.((......((((((.(((.(((((((....((((((((..((((((((((((.....(((((((.(((((......((.......)).((.((.((....)).)).))))))).))))))).....))))).)))).)))(((((((((((.(((((((.(.(((........))).).)))))).(((((((.(....))))))))).))))))))))))))))))))))))))))))))).)).......((((((....)))))).((.(.((((((((((.(((((((((.......))))))....(((((.(((.....)))..))))).((((..(((((........)))))))))........((((((.(((.(((((.((((..(((.(((((((((((.((.((............((((.(((((......))))).)))).((((((..(((.(((((((..(((((((((((((((.((...((((((...(((((((((.((((((((((...)))))))....((((((((((.((.(((((....))))).)).((((.....))))(((((....)).))).((((((((......((((((((.(((......))).))))))))..)))))))).(((.....)))(((((....(((((.((.(((((((...(.((((((.........(((((((((....))))).))))..((((((((((.(((((....((.(((.(((..((((((((..((..((.((......)).))..))..)))))))).)))...)))))....))))).))).))).))))...((((((((....))))))))((((((((((.....(((.((((((((((.(((((((((((...((((((......))))))(((((......(((((((((((((..(((((((((((((((.(((.(.(((.(..((((((((.....((((((((.((...(((.((((((((....))).(((((((.((.(((((.(((((((((.(((((((((((.....((((((.(((........))).))))))...)))).))))...((((((((((((((.(((.((((((..((((((.((.((((((.(.(((.(((.....(.((((.(((((((((..((((((...((...((((...((((....(((((((((......))))))).))....))))....)))))))))))))))))))...)).)))).)((.(((((..(((.((((.((((((.((((.....(((..(((....))).)))....)))))).))))..(((((((.((.((((.(((((((.((((((....((((((((.((......((((((((((.((...((((.((...(((.(((.((((((((((((((((.(((((((..((...))..)))))))(((((..((.((((....)))).)).(((.(((..(((.((((........)))).)))..))).)))..)))))...((.((......)).)).))))))))))......((.(((((((.(((((((.....((((((.(((((((((.(((((((..(.((((((((((...(((((((.(((.((((((.((.......(((((.......)))))...)).))).(((.((((...((((...........((((((((((.(((((((((((.....))).(((((((((.(((..((((((.....))))))..)))..........(((.((.((((.....))))..)).)))......)))))))))(((((((((....))((.((((((((((((((..(((.(((.((((.......)))).))))))..))))((((((.......))))))((......)).......(((((((....))))))))))))))))))).)))))))..))))).))))))))).....(((((........)))))..))))))))...)))).)))))).))).)))))))......)))......).)))))).)..)))))))))))))))).)..(((((((.((((....))))....)))))))))))).....)))...((((((((.(((((((((.(((..........))).(((....)))))))))))).))))...((((((...)))))).))))........)))).))))))).))...)))))).))).))))).)))).)).))))))......))))....)).))))))))...((((((((((...(((((((....((((((..((...))..)))))).....(((((((((.......))))).)))).....))))))).....)))))))))).....(((((((..(((((((.((((..(((.......(((((((.((((((((....))).)))))..))).)))).)))..)))).(((((((...((((((.((.(((((...(((((((.(((((..(((((((((..((..(((((((((.((((((.((((((((((.((((........)))).))).))..((.(....).))..(((.....)))))))).)))))))))..))))))..))....((((....)))).)).))))))).))))))).))))).............((((....).))).(((((.(.((....)).).))))).......(((........)))(((((.((((((((((((..((.((((.(((.(((((.((((.....)))).))))).)))((((((....))))))((((((.....))).))))).))))..)).)))))))))))))))((.(((((.((............)).)))))))...((((((((((..((((((((((..............)))))).)).......((((...((((....))))))))(.((((..((((((((.....(((((..((((..(((((.((((((..........)))))).((..((..(((((((.((.....)))))))))))..))((((((.......))))))...))))))))).))))).)))).))))..)))).)...........((.((((...((((((((((((((((..((((..((((((((((.((((.((((((((((..(.((((((..(.(((((((((.((...((......))....)).)).))))))))..))))))))))))))(((((.....))))).(((.(......).))))))..))))))))).)))))..)).))..))))))...))))).))).))....)))).))...((((((....))))))..))..))))))))))....)))))..)).))))))..(((..((((.....))))..))).)))))))....))))..))).)))))))...)))))).))))))).)))))).))))))).....((((((((((.......)))))))))).))))..)))...))))))).......))).)))...).)))))))))))))))))))).......((((((........))))))..(((((((((((((.((.((.....)))).(((((((((((((((((.(((..(((((((....((....))....)))))))((((...))))......))).).)))))).(((((((((((((.....))))))))))))).((((((...((((((((.....((((..((..(((((((...((.(((.(((.(((..(.(((((((.((((...((.((.(((((((((((((((((((((((((.((((.((((.(((((.....(.((((((...)))))).)..)))))..((((((.....)))))).)))).).))))))))))))((((.((((((((.....))))))))))))(((.(((((((.((((((.((((((((((....))))..)))))).))))))((((((.........))))))......)))).))).)))...))))))))))))).)))))))...))))))))))).)..)))..))).))))).)))))))..))..))))...))))))((((((((((.(((.(((((.(..(((((.((((((((...((((.((((.....((((..((((((.....((((((((.((.((.(((((((((((............(((..((.((((((((((.(((.......(((((((((...((((.......))))........))))))))).))).))..)))))))).))..)))...)))))))))))..))..)).))))))))...)))))).....)))).((((((..(((.........)))...)))))).((.(((((((((((..(((.......)))))))))..).)))).)))))).))))((((((......))))))(((((((((...))))))...)))...)))))))).)))))..))))).).))).))))))))))(((.(.(((((((...(((((...))))).(((((((((((((((...((((....)))))).)))))).))))))).....)))))))).)))((((((((..(((..((((((.(((......)))))))))(((((((.(((((((((((((((.........))))).)))..)))).))).)))))))((((.......))))))))))))))))))))))).((((((((((.((((.((((((...))))))))))..)))(((((((.....((((.......))))....))).)))))))))))(((...(((((((.(((((.....(((((.......))))).....((((.....))))(((....)))..))).))...))))).)).)))(((....)))....))))))))))..)))))))))))))..))).))).)))..(((((((.(((((..((((..(....)..))))...((((((((((......))).(((((((((.((((...(((.((........)).))))))).))))).))))......)))))))........(((((.......)))))(((((.(((.((((.....))))))).)))))(((............)))))))))))))))....))))))))))).)))))))))((.((.((((...)))).))))(((((.((.(((((((((((((.........((((((((((.(((.((....))(((((.........))))).))))))))))))))).)))))))))))))..))))))))))))))))))).(((((...)))))......((((.((.((.((((((.((..........)))))))))).))))))(((((((..((.(((((((((((.(((((((((((..(((((...))))).(((((((((....((.((...(((.((.(((((.(((....(((..(((.((((.....))))))).))).((((((((....)))))))).)))))))))).)).)...)).))..))))))))).....((((((((..((((.......)))).))))))))..(((((.(((((((((((((((.(((((......)).))))))...))).))))))).)).)))))...(((...)))...))))...............))))))))))))).........))))).))....((((((((((..........((((....)))).))))).)))))...........((((((((.((((....))))..)))))))).))))))).))))).))))).))))))))))))))))...).))).).))))))).)))).))))))).)))))))....))))))((((((((((.((.(......).)).))).)))))))).))))...))))))))))).))))).))))).(((((((..((((((((((....(((((.(....)))))))))))((((..((((((((((......((((((((((((((((...((((..(.....)..))))...)))).((((((((.....)))....)))))............))))))))).)))........(((((.(.((((((((((.((((.((...(((((((((.(((((.(((((.(.((((.......))))..).)))))....))))).)).))))))))))))).).)).)))))))))))))))).)))))))...).))).....))))).....)))))))..........))).....)))))))))).((((((((......((((((((((((((((....)))))).........((((((((((((..((((((....(((((((((((((.(((((......)))))(((((.....)))))((((.(((.(((((....(((.(((((..(((((((((((..((((((((((((...((((.((((((.(((((((((.((......(((((((.(((((((((((....((((.(((..(((((....)))))..))).)))).....)).))))))))).))))))).....)))))).........(((....)))((((.(((((((((....)))))....))))))))..))))).))).)))..)))).....(((.((........)))))))))))))).)))....(((((((..(((((((((..((((...(((..((..((.((((...))))))..))..)))))))..)))))......((((((.((.(.(((...))).)))))))))))).)..)))))))....(((((..........))))).))))))))))).))..))).)))))))).))).))))))))).))))))))...))))))...((((((((.(........).)))))))).........)))))))))))).......)))))))))).......))))))))...)))))).).)))))))...)).).))))...)))))....((((....))))...((((((.((....)).)))))))))))))))).))).))))).))))..))))))..))))))))))))))..((((((((((((((...(((((((((((..(((((...(((((...((((((.(((..((((......(((.((((.((((((((((.(((((((....))))))).)))...........(((.(((((.((((((..((((.((((((..(((((.(((((((.(((...(((((((......))))))).))))))))))....)))))..))))))..)))).....)).))))..)))))..)))))))))).))).).)))))))(((((((.(((((...)))))..)))))))..((((((....((........)).....((((((((((((.....((((((((((((((((((..((((.......))))..).)))))..)).))))))))))...)))))).).)))))..((((.......))))......))))))(((.((.(((((.(((...)))....)))))..)).))).)))))))))))))).....)).)))....)))).))).)))).....))))))))).)))))..)))..)))))))..)))...))))))....((((((.......))))))(((.(((((.(.((((((((...((((((((.((((.(....))))).((.((((((((...)))))))).)).....((((((((.((........)))))))))).........))))))))..((((....))))..((((((.(((((..(((......)))(((.(((.((((((((((....(((....)))..))))).).)))).)))..))).......))))).))))))((((((((.(((((.......))))).))))))))))))))))..).)))))))))).)).))))))))))))))((.((((.((((.(.((((....)))).).))))))))))...((((..(.(((...))).)..))))((((((((.(((.((.((((((...((((((((((((((......((.((((((((.((.((.((.((..........)))).)))).)))))))).)).((((.((.((..((((((((..((((((.((((((((........))))))))(((((((........))..(((((......((((..((..........))..))))......)))))...((((((....)))))).((((((...)))))))))))))))..))..))))))))..)).)).)))).(((((((..(((((((((((((((....)))).....((((..((((((((.((((.((((((............))))))))))))))))))..))))...(((((.((((...(((.....))).))))..)))))(((((((((((((((((.....((((((...(((((.(((((.(((((.(((...)))))))).))))).)))))..))))))....))))..)))...)).)))))))).(((((....)))))(((..((.(((((((((..(((((.(((((.....)).))).)))))((......))...))))))))).))..)))..........(((((.(((.(((...((((((..((......))...))))))...))).)))))))).))))))))))).)))))))((((((.(((((.......))).))))))))....)))))))))).))))(((.(((.......))).)))...((((((((((((.((((((..(((((((((((((((.(((((..(((((((...(((((..((..(((((.(((((((((((.....))).))).))))).....)))))....))..)))))....)))))))...)))))((((.((((........)))).))))........)))))))))).(((.....)))...((((((((((((...))))))))))))....(((((((.(((....)))((((((((((.(((.....))).)))))))).)).))))).)).......)))))..))))))))).)).)))))))((((((((((..(((((((..((((.((...)).))))..))))))).((.((...((((((((((((....)))).)))).))))...)).)).))))..))))))...))))))))...))).).)))))))...........)))).))))))))..))))))))).))))))))))))).))))))).......))).))))))))))))........))))))).(((..(((........)))..))))))))))))).))))....)))))))))..)))..........)).))))))))...(((((((..(((.(((((.((((((...((((((((.(((((((((..(((((...(((.((((......)))))))((((((.((((((((......)))(((((......)))))))))))))))).(((((.((....(((((((.....)))))))...))..)))))....)))))...))))))))).))))))))...)))..))).)))))(.((((.......)))).)..((((((((.(((.......)))........(((((.((((...........)))).)))))...((((((....))))))....))))))))..........)))..)))))))..(((.((.((((...)))))).)))(((...))).((((..((......)).))))..............(((((((((((.(((((((.....))))))...(((((((((((((.....))))).))))..))))....).)))))))))))(((((((.....(((........)))))))).)).........))))........
Thermodynamic Ensemble Prediction
.((((,((((((((((((..(,(((((((((({,.((..(({((((((((.((((.,(((.....))).}.)))).))..))))))})|..}}...,}))))))))),|.}))))).)))))},,.((((((((.(((((.((((,,((,((((((...)))),(((((((((((((.(((((((((((((,(.((({.....).)))))))))....))))))..,,,.)))))).)))))))|(((.(((((((((((((((((.{{,.((((((((((..((((((((.....)))..)))))..))))))))).|,|}.((((((((.((((.(((....|,....(((((.({......((((((.(({{(((((((....((((((((..((((((((((((.....(((((((.(((((......((.......||.((.((.{{....)).)).))))))).))))))).....))))).)))).)))(((((((((((.(((((((.,.(((.,......))|.|.)))))).((((((||{....))))))))).))))))))))))))))))))))))))))))))).)).......((((((....)))))).((.(.((((((((((.(((((((((.......)))))((((.({..,.||.}}}}{{|.{,{{,|,.((((..{((((........))))))))),.},).)}|(((((.(((.(((((.((((..(((.(((((((((((.((.((.........,,.((((.(((((,,..,,||}||.||||,|{{,(((((((.(((((((.....(((((((((((({((...((((((...(((((((((.((((((((((...)))))))....((((((((((.((.(((((....))))).)).((((.....))))(((((....)).))).((((((((......((((((((,({,....,,))}.})))))))..)))))))).(((.....)))(((((....(((((.((.(((((((...,.{(((((.........(((((((((....))))).))))..((((((((((.(((((....((.(((.(((..((((((((.,((,,((,((......}}.))}})}.,)))))))).)))...)))))....))))).)))}}))}})))...{(((((({....}))))))|(((((((((({....(((.((((((((((.(((((((((((.,,((((((......)))))){{{{,......(((((((((((((..(((((((((((((((.(((.(.(((.(..((((((((...,,((((({((..{{{,({(,{(((((((,...},,.((((({((((.(((((.(((((((((.(((((((((((.....((((((.(((........))).))))))...)))).))))...((((((((((((((.(((,((((((.(((((((.({.(((((({({({(,(({....,{,{{((,(((((((((,{((((((,,.({,{{{{{,..|{,{{{.,{{{..((((...(((((......)))))...)))),,.},)}}}))))))}}}}})).||,|||||}.|((.(((((..(((.((((.((((({.((((....,{((.{(((...,|}},|||,..,||}|||,}}}}..{((((({.{{.((((,({{({((.{(((({.,..((((((((.((......((((((((((.{(...((((.(({..{((.(((.((((((((((((((((.(,(((((...}}}})...}}}|||,(((((..{(((.(((..((((((((..,...|..))))))))|........|}}..}}},..)))))}}.)))}},.{((.,,.,,,..)},},.))))))))))......{,.(((((((.((((.(((.{{{(,((,(((((((((({{(((((((.,({((((((((((.,,,{({(((.,({.,,..,,.||..,,,,,{{{{{......,)))))..,}},,,.,({{.{(,,...{{{{.....,,,,,,(((({({{{,.,,,,,|((||,.,,,,||}}|((((((((.(((..((((((.....))))))..)))..........(((.((.((((.....))))..)).))).......)))))))|((((((((({,{...{{.{(((((((({((((..(((.(((.((((.......)))).))))))..)))}((((((.......)))))).,,..,,,||,.|.|,{,{{{{||...,))))))))))))))))))),))))))),,{||||.,,||||||,{,...(((((........))))),,})}}})))...,))}})),|}}.,||{|||,,,)}}}}}.},}}}}.,,),))}}))})},)))))))))))))))}..{((((((((,((((....)))).,..)))))))}}).,.}}.})))}}}}}.{((((,(((((((((.{{{..........})).{{{....})}))))))))).),,),}}|((((({.,|,,,.,..}))))).....)))).))))))).,)...)))))).))).))))).)))).}}.))))))......))))....)).))))))))...((((((((((...(((((((....(((({{,{{{...},.,)))))).....{((((((((.,...,.)))))},))}.....))))))).....)))))))))).....{{{((((,.((,,{||,||||,,|||,,.,{{{{{{,,{|}|||||{{{....||},}}}))}}|||,||||.|||..}}||.(((((((...((((((.((.(((((...(((((({.(((((..(((((((((.,((..((((((({(.((((((.((((({({{({((({...,,...}}}}.})}.)),,|{.,.}}.},....{((.....))}))))).)))))),,,.}))))))..)).,..((((....)))).))}})))))).)))))}).)))))..........,{{((({...,|,|}||{{{{,.|}{|,,,,})})}}})}},,,....{{{.,,...,,)}|(((((.((((((((({{({,((.{{||,|||,(((((.,{,,.}}}}),||.|||||.|}}{((({{,...}}}}|}{(((((,,.,,})}.)))}},))})|,}}.))))))))))))))).|||((({{(((({,.,,....,)))))))))).,.(({(((((({.,(({{(((((({{{{{{{{{{{{{.,||||,.,{,,,,..{((((,{{((,,.,{,||{,...|||||{|..{{}}||}||{{{.,,,||}}|||{.,|{{||,((((((,,......}.)))))).{{..|{,,(((((((.((.....)))))))))))}})){{||||,..,,,,))))))..,)))}}}}}}.))}}}.,.,.,||.{((((((,.{((((.,,{{({...))),.}}))))).}}))))))),..}}))}})))}}),}}}...(((.((((((((..(.((((((..(.((((((({{.((...(,......}}....)).)).)))))))}..))))))))))))))).))).....)))))}}|,}}),|||||||||||{{{|||{{.|,,...}.}.})))))).)).)))}.,}}.}},))).},.,)}}}}}},....((((((....))))))..))}.))))))}))),,..))))}..)).}}})}}..{{{.,{(({.....)))}..))).||}||||.,..|}||..})},}}))})},,.)))))).))))}||,}|}}}}.}}}}}}}.....((((((((((,.....,)))))))))).}}})..))}...}})))}}.,,..,,})).}))..,},)))))))})))))))))))).......{((((({.....}.)))))}..((({(((((((((.{{.{{,..,.}}}}.((((((((({{(((((({(((..(((((((....((....))....))))))){(({...}))}...,}})}}.,.)))))}.(((((((((((((.....))))))))))))).{(((((,,.{{((((((.,,..((((..{{.,{((((((...{{.(({.(((.(((..{.(((((((.((((...((.((.(((((((((((((((((((((((((.((((.((((.(((((.....{.((((((...))))))....)))))..((((((.....)))))).)))).).))))))))))))|(((.((((((((.....)))))))))))}(((.(((((((.((((((,((((((((((....))))}}))),)).))))))((((((.........))))))......)))).})),)))...})))))))))))).)))))))...))))))))))).}..)))..))).})))}.))))))}.,)),,)))),,.))))))((((((((((.(((.(((((.,..(((((.((((((((...((((.((((.....({((.,((((((.,...((((((((.((.((.(((((((((((.,,.........{((..((.((((((((((.(({.......(((((((((,..{{{{....,..)))),,,.....))))))))).))).))..)))))))).))..))),..)))))))))))..))..)).))))))))..|))))))...,,)))).((((((..(((.,,....}.)))...)))))).((,(|{({((((((..(((.......)))}))))}..)|}))).}})))).)))}((((((......))))))((({(({((,..},}))},,.))}...)))))))).)))))..})))),|.))).))))))))))(((.{.(({({{{,,,(((((,,,|}}}}.{{{|||||{{|||||,,.{{{|,...}))))},)))))),))))))}.....)))))))).}))||{({(((,{(({..{(((((.(((......))))))))){((((((,(({|({({(((((((......,..))))).))),.}))),)}}.)))))))|||||,...},))))|||}}}}})))},)})))},({(({{{(((.(((,{((((((...))))))))))..)))(((((((.{,{,{{({.......)))),}..))).))))})))|||(((,,.,{(((((.(((((.....(((((.......)))))...,.((((.....))))|{{...,))}..))).)}...))))).)),}||(({....))}.,,,}))))))))}..)})))))))))))..))).))).)))..(((((((.(((((,,({{({{(,,..|..}}}}...(((,,,((((......,))}|,||}||||}|.||,..((((.((((((.....))))))))))||||,|(|{,{(,..({|,,.{,,.....})),.))}..)))}})))(((((.(((.((((.....))))))).))))){{{............)))))))))))))))....))))))))})).))))))))){{.((.((((...)))).))}}(((((.((.((((((((((({{.........(((((((({{{(((.(({{..,,{{,,,.........,)))).)))))))))))))}},)))))))))))))..))))))))))))))))))).(((({|..|||||{....},|||}|{.{(.((((((.({..........)))))))))).)),})}||{{|||,,|.,|||(({((((((((((({(((({,,(((((...})))).(((,((((,.{{((,.......|}}|,.||||,}||,...|({(,.{((.{{{,...,{||||||,.|||.((((((((....)))))))),|||}}})))).}|,|..,{|{||,,|||||}|}},,.{{((({{{{{..{|||,,..,..}))}.}}}})))),.|||||}|{(((((((((({((,(((({......)}.))})))},.))).))))))).}|{||||},..{{{...)})),)))))}.........,,,..))))))))}))},.,.,,}}}},}}}},})},..((((((((((..........((((....)))).)))))}}))))...........((((((((.((((....))))..)))))))).)))))))}))}}}}))))}})))))}))))))))))...).))).).))))))).))))}}}))))).)))))))....))))))((((((((((.((.(......).)).))).)))))))}.,}}}...))))))))))).))))).))))).(((((((.{((((((((((,...{((((.{....}))))))))}}(((,{{((((((((((.....{((,(((((((((((((...((((,.,.....)|,})}}...)))).(((((({{.,...))}...,)))))............))))))))).,}}},.,....(((((.(.(((((((({(.((((.((...(((((((((.(((((.(((((.(.((((.......))))..).)))))....))))).)).))))))))))))).}.),}))))))))))))))))}}))))}),}}).)))...,}))))).}...)))))))..........)))....,)))))))))),((((((((,,....((((((((((((((((....)))))).........((((((((((((.,((((((.,..(((((((((((((,(((({......}))))(((((.....)))))((((.(((.(((((,...{((.((({(..(((((((((((..(((((((((((((.(((((({(((((...((.,,,,.||..}}}}||(((((.(((((((((((....((((.(((..(((((....)))))..))).)))).....)).))))))))).)))))}}.....}}},}|((,{((({(,....(((({,(((((.((((,((,..,,,,,,.,,.}))})))).})).)}.).)))).....))).,}),})}))..,))))}...).))))))))).)))....((((,...}}||,{{(((..,|||..,(.(,{((({{{,..{{{|||},,}}}}}}{{||,||||{{|,}}}......((((((.((.(.(((...))).))}))))))|}|.|...,.))))|},.}||))}},}.))),,}}}...))))))))))).})..))).}))))))).))).))))))))).))))))))..,))))))..,((((((((.{........,.)))))))).........)))))))))))).......)))))))))).....,.))))))))...}})))),}.)))))))...)).).))))...)))))....((((....))))...((((((.({....)).)))))))))))))))).))).))))).))))..))))))..))))))))))))))..((((((((((((((...(((((((((((..(((((.,.,((((...((((((,(((.,((((..,...{{,{((({,{{((((((((.(((((((....))))))).)))..,||||,,|,((((({{((,(((({,,,.{{{.{{{{{|..(((((.(((((((.(((...(((((((......))))))).))))))))))....)))))..))))))|,,{|||||{(((((((...)))}})))).,)))))).))}}},)}},}))||||||{.{{{||,,,}}))),.))))))).,|||{{,....,,........,,.,,..((((({((((((.....(((((((((((((((((,,.((((.......))))..).)))))..)),}))))))))).,.)))))).}.)))))..((((.......))))......},|||,{{{.,{.(((((.{{{...}}}.,,.)))))..}),))},))))))))))))))}}...))},))....)))).))).)))).....))))))))).)))))....((((((((((.({(((....))).)))))))))))}..,...))))))).)))}}))}...||{{{..|||{(((.||,,|.|..,,))))}.|.{{.((((((((...)))))))).)).,,,{((((((((.((........)))))))))),.....,.{(((((..|,{,,,,...,)),|((((((((((({....(((......)))(((.(((.((((((((((....(((....)))..))))).).)))).)))..)))...{((((((...{,{((((((({...)))))))))....,.))))))))))))))))))})))))).})))}})).)).)))))))))))))),(,((({.((((.(.((((....)))).).))))})}},,.}}|||...,.,..{{{|...}}})},|((((((((.(((.({.((((((...((((((((((((((......((.((((((((.{(.((.((.((.,........)))).))}).)))))))).)).((((.((.((..((((((((..((((((.((((((((.{,...,}))))))))(((((((........)),,(((((.,..{.((((..((..........))..))))...,..))))),,,((((((....)))))).((((((...)))))))))))))))..))..))))))))..)).)).)))).,((((((..{((((((((((((((....)))),(,..((((..((((((((.((((.((((((............))))))))))))))))))..))))..{(((((.|(((...((({....}}}.)))}..))))}(((((((((((((((((.....((((((.,.(((((.(((((.(((({{(((...)))))))).))))).))))),.))))))....))))..)))...))}}))))))}.(((((....)))))(((..((.(((((((((..(((((.((({{.....}}.))).))))),{......},...))))))))).))..)))..,}}.....(((((.(((.(((...((((((..{{......})...))))))...))).)))))))).))))))))))).))))))|((((((.(((((.......))).)))))))),...)))))))))).))))(((.(((.......))).)))...((((((((((((.{(((((..(((((((((((((((.(((((..(((((((.,,{((((..((..(((((.(((((((((((.....))).)))}})))).....)))))....))..))))),...))))))}...)))))((((.((((........)))).))))........))))))))))|(((...,,|||,,.((((((((((((...))))))))))))..,.|||{{{{.{{{..,,))){{{(((((((.(((.....))).)))))))),)),))))),)},),,...)))))..)))))}))).)).)))))))((((((((((..(((((((..((((.((...)).))))..))))))).((.((...((((((((((((....)))).)))).))))...)).)).))))..))))))...))))))}}...))).).)))))))}..........)))).))))))))..))))))))).))))))))))})).})))))).....,.))).))))))))))))........))))))).(((..(((........)))..))))))))))))).)))}.}},)))))))))..)))..........)).))))))))...(((((((..(((.(((((.((((((...((((((((.(((((((((..(((((...(((.((((......)))))))((((((.((((((((......}}}(((({......}))))))))))))))).(((((.{{....(((((((.....)))))))...}}..)))))....)))))...))))))))).))))))))...)))..))).)))))|.|{{{.......)))),,.,|{{{{{.,,,{,..(((((({.........(((((.((((.........,.)))).)))))...((((((....))))))....,))))))).........,)))},)))}))).,{((,{{,((((...)))))}.}}},,|}}}))},||||.,|}}},},.))})))},,............(((((((((((..((((((.....))))))...(((((((((((((.....)))))}})))..)))),}}})}))))))}}}},(((((({....{(((........)))))))).)).........))))........

Transcripts

ID Sequence Length GC content
AGCGGAGCUCGCAUCCUCGGCGGGGCGGCUGUGCAGGAGGCGGCGCCCG… 10713 nt 0.6186
Summary

This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human left ventricle tissues demonstrated that the DCHS1 was a top-ranked sudden unexplained death susceptibility gene in a tier characterized by post-mortem expression increases, and its simulated knockdown/knockout was used in a partial least squares-discriminant analysis to effectively recognize expression differences between normal samples and simulated SUD cases [Shen et al. DOI:10.1007/s00414-025-03575-2].