Basic Information

Symbol
DCX
RNA class
mRNA
Alias
Doublecortin LISX DBCN SCLH XLIS DC Neuronal Migration Protein Doublecortin Lissencephalin-X Doublecortex Doublin Lis-X Doublecortex; Lissencephaly, X-Linked (Doublecortin)
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry-related diagnoses

MANE select

Transcript ID
NM_001195553.2
Sequence length
9086.0 nt
GC content
0.4232

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2572.20 kcal/mol
Thermodynamic ensemble
Free energy: -2749.76 kcal/mol
Frequency: 0.0000
Diversity: 2596.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((((((((((((........((...............))))))))))))))))).((((((((........))))))))..(((((((.....(((.(((((((...(((...((((((...((((((((.((((......))))..))))........(((((((((((((((.(((((((....((((......((((((((((.(((..((((((((...........((((......))))....(((((((((((....((((((((((((((..((((((...............))))))......(((((((((.((..(((((((((.((((((.....................)))))).)))))))......(((((((..((((((((((((((..((..((((((((......((((((.(((.........))).)))))).((((..(((((......((((.....))))))))))))).))))....((((.(((((..........((((((((((...((((((......(((((((((.(((.......)))...)))))))))......)).))))((((((((((((.(((((((.((((((..((((((((....((.((((((((.((.((.(((.(((((.....)))))))))).)).))))))))))....))))))))..((((((((((((......((((((...((((((.......))))))...))))))(((((..(((((...))))).)))))((..(((((((((.((..(((((.(((...((((((((..((((....((((.((((((((.(.((...(((((.......)))))...)).).))).)))..)).))))....)))))))))...)))..))).)))))..)).))))...)))))..)).(((((.(((((((......(((......)))((((.......))))..(((....)))..(((((....(((...)))(((((..((..((((((.....(.(((.((((.((((((.(((.((((..(((((((((.((((...((((..((.(((((((((........)))))).))).)))))))).)).)))).....)))))......)))).)))..)))))).)))).))).)......(((((..............)))))))))))..)).)))))...)))))...))))))).))))).....(((....((((..(((.(((...............))))))..))))....))))))))......))))))).((((...(((...((((.....))))..))).....))))))).))).).))))))...)))))))).))))..((((...((((((((.((..((((.(((.(((((....))))).))))).))..))..))).))))))))).....((((.(((((((((....((((.....))))(((((........)))))...........))))))))).))))........)))))))))).......))))).)).)).)))).))))))).))))))).))..))))))).........))..)).)))))))))(((.(((..((((((.((.........)).))))))..)))...))).((((((((((..(((((.((((((((((.................))))).....))))))))))............))))))))))...((((((((...(.((((((((((.......(((((((.((((....((((((((........))))))))((((((..((((......))))((..(((((((...(((((((...(((((.....(((((.(((...........))).)))))..((((((((((((...(((((..((((....))))....)))))..............(((((((((((((((((((((((..........(((((((((..((....)).)))))))))(.((((......)))).)..(((((((((.(((...........))).)))))))))(((((.(.(((.((((.((((.....(((((..(((..((((((......((((((.(((((((((((.........))).)))))))).))))))......))))))..))).))))).....(((((.(((........)))..)))))...........))))..))))..)))).)))))))))).))))..))))))))))).)))......))))))))))))...)))))..)))).)))...)))))))..)))))))).((((..((......))..))))..(((((((((........(((((............(((((.(((..(((((((...((((((((..(((....)))...))))))))...((((.(((((....))))).))))(((((((..(((......)))..)))))))..))))))).))).)))))....)))))........)))))).))).(((......))).......(((.......)))))))))).))))..)))))))))).)...))))))))...((((((((..........)))))))).((((((..............))))))((((((.((((((((....))))))))..))))))((..((..(((((((............)))))))))..))(((((((((((((((((..((.(((((((((.((((((..((((.((((......)))).))))..)))(((........)))....((((((.....))))))..(((.(((((((((.((....((...((((((((..((((((((((((....)))...((.(((((((.(((((((.(((....(((((((((.(((....))).))))(((.((((...))))))).(((((((((.((((.(..(((((....((.((((.((.(..(((........))).).)).)))).))....)))))..)))))))))))))).(((((...........................(((((((.((((.(((((....)))))...))))....)))))))..(((((((((........)))..)))))).(((((((......(((((..(((((.((((((......(((.(((.(((((((.........)))))))....))))))))).)))))))).)))))))))))).))))).......(((.(((.(((......))).))))))..((((((((..((((.....((((..(((((((........)))))))(((((..(((((((..((.(((((((.........((((((((.((((.((((((((..((((((((((....))...))))))))..(((....)))(((((.........)))))......)))))))).........))))..))))))))(((((((((....))))))))).(((...))))))))))..))..))))))).))))).))))....))))))))))))..........(((....((((((.((.........))))))))....))).)))))))).))))))).))))))))).................................(((((((............)))))))...)))))))))......))))).)))..))...)).))))))))).)))....))).))))))))).))..))).))))))))))))))...)))))))))...))))).(((((((((....(((...(((((.......))))))))...))))))))).(((((((.............((((((((((((((...(((((......(((((((.....((((.((......((((((((((...))))))))))..(((((((....))))))))).))))....)))))))...((((....)))).))))).))))))))).........((((((((((((((((((((((.((...((((......))))..(((((((.((((....((((.(((((......)))))...))))....(((((......)))))..((((((((..(((.(((..(((((.((((((((((...)))))).))))...((((((......)))))).(((((((((..((((((..((((......))))(((((((((....))))))))).(((((.((........)).))))).)))))).........)))))))))........(((......................)))(((((...((((((....((((((((..((((..(((((((((..(.(((.((((....((((((...(((.(.....).))).))))))))))))).)..)))))).)))..))))))))).))).))))))...))))).)))))))))))..))...))))))......)))).))))))).(((((((.......))))))).((((((((......))))).))).)))))))))).)))).((((...((...((((.(((((((((....(((...((..((((((.((((((((((((...........(((((((.........)))))))........((.(((((.((((.((((((((...(((((...(((((...((((.(((((.((((((((..........)))).)))).(((((.((....)).))))).((((..(((((((..((((((...((..(((.....)))..))...))).)))))))))).))))........(((.(((((((((...))))))))).....((((((.........)))))).(((((.....)))))..((((((..((((((.((...(((((...((((....)))))))))..))))))))..(((((((....((((.((....)).)).))...)))))))..))))))..((((((((.....((((.......))))...))))))))..))))))))))))....(((((...(((.((..(((((.((......((.((((.((((.....................)))).)))).))......)).)))))..))))).)))))(((((......))))).)))))...)))))...).))))))).)))))).))))))))))))).....).)))))))))...)).)))...))))))))).)))).))))))......((((..(.((((.(((((.((((.((((........)))).)))).....))))))))).)..))))((((((....(((((..(((((((((((((((((..((((..(((((.....))))).))))..........((((.(....).))))...(((((.........)))))...(((((((.....(((.......(((..(.((((((((....(((....((((.((..(.........(((((((.........)))))))((((......)))).((((((......))))))................(((((...))))).)..)).))))...))))))))))).)..))))))))))))).))))))))))))))))).)))))..)))))))))))))))))))))....)))))))(((((((((.(........)))))).))))..)))..))))))))(((((((((((((..(((((.(((((.(((((.....)))))....)))))..(((((.(((((.....(((((.((((((((.(((.(((....)))))).....(((((((((((((...(((...((((((..(((((..........(((.((((((((((((((((((((.(((.....))).)))....(((.((((((((((((((.((....)))).)))))))..))))).))).....((...((((.((((((.(((.(((.....(((((..(((((((((((......(((....)))......))))))))))).....((((((((((((((((((((((((((((...))).(((((((...((((((...........((((((((((.((((((((..((((((((.....)).))))))......((((((......))))))..(((......(((((((((((((((((((((((...(((((((((((((.(((....)))))))).............))))).)))..)))))))))))...)))))....)))))))......)))....(((((........))))))))))))).(((.((((((((..(((.((((.....(((((.((((((((((((((((((((((((((((((((.(((..........((((((((......(((((((.......(((.....)))....((((....).))).......(((............)))(((......(((....)))........)))(((((((((((((......(((((.......................((((((............................))))))..................(((((.(..((((....))))..)))))).)))))..........)))))))))))))........((((.....(((((...((((((((((.((..(.........)..))..)))))).))))..))))).)))).................................)))))))..)))))........))).........))).))))..)))))))))))))))))......))).))))).......(((((((((((..((((........((((((.(((((.(((((...((((..........((((((.......(((((((....)))))))...))))))............))))...))))).)).)))))))))........))))..............)))))))))))))).)))))(((.((((.......)))).))).(((((((((((((..(((((((((((.((((((((.((....(((((................)))))((((((((...(((((((((((((((..........(((((......((((((.(((........)))))))))......)))))..........))))))...))))(((((((((.(((..(((.(((((..(((..(((...((((.((((((......((((((.((........)).)))))).....)))))))))))))..)))....)))))..)))..))).))))))))).....)))))...)).))))))..(((((.((((.((.((((((.(.((....))).))))))......)).)))).))))).((((((((((....((((((((((..(((((.(((.(((.......))).))).((((((((.........))))))))..)))))....))..)))))))))))))))))).......((((((.((((....))))..))))))......))))))))))..)))))).........(((((((....((.(((((.((((.............))))..))))))).......((((((((((.......((....)).......)))))).))))((((((((.((((.(..........).))))...))))))))....)))))))......((((((((...(((..(((((...)))))......(((((((((.(((........)))..)))))....)))))))...))))))))((((((.......)))))))))))..))).)))))))))).)))).))).)))))))).)))..(((.(((.((((....))))))).)))))))))))))...........))).)))...))))))).....................(((((((......))))))).))))))).....((((.((((((((((((...)))).......)))))))).))))......))).))))))).))))))))....(((((((((.(((...(((((..((..((((....))))..))..))))).))).))))))))).((((((((..((((.((((.....)))).)))).))))))))......)))))..))).))).)).))))))))...)).............))))))))))))))))).)))..........)))))............)))))).....)))...)))))).)))))))......)))))))).))))).....))))).)))))((((.((..((((.....))))....)).))))..))).))..))))))))..)))))((((((......))))))..((((((((....(((.((((..(((..(((((....))))).)))....)))).))))))))))))))))))))))..))))))))))....(((((.(((.....(((((...........))))).......)))..))))).......))))......)))))))...)).))).....)))))))))).((((((((((((........)))))))))....)))(((((......)))))...))))....)))))).)))....)))).))).)))..((((((.(((.(((.((((....))))))).))).).))))).....)))))))...................
Thermodynamic Ensemble Prediction
....(((((((((((((((........,,...............},))))))))))))))).((((((((........))))))))..(((((((.....(({{(({{((({..,({{{{{{,(((,(,.{{.,{{{,||{|,,,,..}|||,.}}}}.}},,...(((((((((((((,(((((((((...,{{({..{{{{((((((((((.(((..((((((((..{(({{{(({({{{,(((((({......})))))},}.}}))}|.((((((,.,..({{.((((({{{{{.....,,,...((((((((((.(((..,..|||.{{,,((((({(.((((((..,{,...........||...))))}}.|}}}}},...,,,,......((((((...(((((((..((..((..((((.(...(((((((((((((((...((((((.....))))))..,{{{{......((((.....))))}}|}}.||.........,{(((((((...,,,.........,(((({..{(..,{,,...,..,,.}}))),.|,,,.....,)),))))))))|((((((({(((((((.,,.(((((((.{{,((........,.)})}..)))))))..{,(((((((((.((.((.(((.(((((.....)))))))))).)).))))))))))))))))).(((((((.((.((((...,,.(((((((.((((((((((.,........,,,,...,,|||{((((..(((((...))))).))))){{.,((({,((((.((..(((((.(((...((((((((,.((((....((((.((((((((.({((...(((((.......)))))...}).)}))).)))..}).))))....))))))))),..)))..))).)))))..)).))))..,))))}..}}..,,,},)))))))))),,.(((......))),,((((.(((((((((((((((((((...((((((({.(((((....((({,({(({{((..,,.....,.(((.((((.((((((.{((.((((..(((((((((.((((.,,{{(({,,(.({{((((((........)))))).))).)}}))})).)).))))}....,))))......,))}.,))}.)))))).)))).))),}..|||||{,.......,,{((,,..,,,.,|||||}},}}})))}}},}}}||,,..,,))))}.,))))))).....)))))...))))}}}}})))))))).........((((((((((..(((({{{(((((((((((...(((((((...{{(,..((((.....))))..))}.....)))))))..({(((({.{({....{(((,((,,.,((((((((..(((,,,{{{((,.{(((,(((.{{{{{..,,))})),}}}}}.}}.,}}|,,,}.}}}})||||,....{{{{.(((((((((.,,,({{,.....))))(((((........))))).........},,)))))))).,}},.....,.{{{{|||(((((((((((......{{....)).......)))).))))))},.,||||}|||,}||,}}|||}}}((((((((((...,,.(((..((((((.((.........)).))))))..)))}})))))))).}),)))).,,))).))))))),)))))}}}))))))))))..)))))),}))).((((((((.(...,.)),}))))))))))))))))..)))}..,((((((...((((,..,,,{{(((,,.....((((((((.,,........,,,..{((((((((...{{{.....,||||.,.,,{{{,((((((.....))))))...{((((((((((,((((..{{{......}|},{{|{,(((,,((((((,{{{(({{{,,((((....}}}}....|,|||||}...........{{{{{{{{{{|||||,{{|||||,}}}},....(((((((((..((....}}.)))))))))|}{{{{....,,}))),,..{((((((((.(((...........})}.}))))))}|,,,,{{({(((.{{{{{((((,....{{|{{..|||,,|{{{{|,,....((((((.(((((((((((.........))}.)))))))).)))))).....,||||||{{|||{|||||,....((.(((((({{..{{((((((.((((.....))))...||||,.}}||,.,},,{||||,,||||{||||..||||||,}))),,,),},,},)}||})}}}},,..||}}}}|}}|||||,.,{{{||,,{{|{|,,,...,|||||..}}|||,....,.,,|}|}||||||}}}}}}}}}}}||}}.}}...,}},...(((({.(((..(((((({...(((((({{..(((,,,,|||...|||}}}},,,,.{{|,|||||,,,,))))).}}||(((((((..(((......)))..)))))))},})))))).))).}))))...})))))))}}}}}}}|||}.,},..(((......)))..,}}},.,,...{{||{|||,{||.|||{{{.{{{,,{{|,|{(((((({...}||||}|||(((((..........)))))}}}.||||||}}},,...,,|,..||},|||,||||.((((((((....))))))))...))))))).)))}..,|,,|||,||}}.}},||(((.((.{..((.(((((((((((((((((,,((.(((((((((.((((((..((((.((((,.....)))).})))..))){{{........}},....((((((.....))))))..(((.(((((((((.{{..{,{{.,{((((((((,.((((((((((((....))),{{(({,(((((((((((((({((,....(({,.,,||.{||.,}}))).))))}}}{(((((((((((.,{{(,,,((((((((((((,.(((.(((((({,{{{.,{{||,|{(({{({..{,{{{...{|{{||{.,{{{,,,{|{|.{{|{{{{{|,{{{{{.,{,{{...........................(((((((.((((.(((((....)))))...))))....)))))))..(((((((((........)))..))))))..{((({{.,|{,{({,{|||({|{(.(({||,...,..(((.(((.(((((((.........)))))))....)))))),}|.}},,,))),))}))))}}))}.))}|)}}}}}.,{{{,{{{,({{......,||,||||||||||||||{||||,,}|||,|||,{..||((({{........,})))))||||})}}},}}}..}}},||,|||,,||,}},}}}}}}}||,.(({..,{{{|(({..((((((((((....))...)))))))).,||{....)),,{{{,.......,,))))}......))))))))}.,,))))))))))))..},))).,,..))))))))))))}})),}||}},{(((((({{(((((((.,((((,,,(({.{{{{||,..,{{{{{{,,,,{{{{.....}}}},..})))))})}},,.,,.....{|{{{{......,})).})}))},,,))),)))}))),,))))))}...)).))))))}.................(((((((............)))))))...)))))))))......}))))},)}}}))...)).))))))))).)))....))).))))))))).))..)}),)))))))))))))))),,).)).}))}}{{(({,,(((((((((..,,,{,.,,((({{.......)))))},)}..))))))))).,))))}((((((((,((,(((.(,.(((((((((...(((((...,{.(((((((.....((({,({.....,((((((((((...)))))))))}},(((((((....))))))))).}))).,..))))))},}.((((....)))).})))).))))))))).,).))}}))})))))))),,}})))}})))},....((((......})))..}))}.))))))))))},,,,,.......)))))))))...(({(((((((((((.(((.....((((,.{((((......})))))))).{((({((((((...)))))).,,,)}}}((((((......))))))..(((((,{,.,{{{{{...((((......)))),((((((((....))))))))}.(((((.((........)).))))){{{.((((((((((((.|{((|...,)))|((((((((({......((({{{{{({.,,{{({,((.{((,..(((({....}))))..,))).}},...,},|)})}}.}.)))....{((((((...(((.(.....).))).)))))))((((.(((((||((((((.,,,..(({{{.,.,.,.))))),...}}}...},......,.{{{.|,.(((((((.((((.((((((((((((({.....}))))))))}......((((((((......))))).)))(((((((..|,{{(((,((((.,,({...((((.(((((((((....(((...((..((((({{((((((((((((.......{{{.(((((((.........))))))).,,,....{{.({(((.((((.((((((((...(((((,,.(((((...{((({(({((.((((((((.,.......,)))).)))).(((((.((....)).))))).((((..(((((((..({((((...{{..(({.....)))..)}...)))}|))))))))).)))}.....,.,{{,.(((((((((...)))))))))...,,((((((.........)))))).(((((.....))))}..,|{{{,..((((((.({...(((({..{((((....)))))))))..})))))))..,{{|||{|,..||||.||....}},)),}}.,,)))}}}},}}))}}},.{({((({{.,,..{{{{.......))))}}})))))}}|,.||{|||||}|||,,.,(((((,..,{{.,,.,(((({.{{{{,,..,{,{{{,.{{{...|,.....,},,}},))}.,))))..)}).)),,....))})})))..}||}}.}}}||(((((......))))}.))}))..,})))).,.).))))))).))))))),)),,)))))))).....).}})))))))...)).)))...))))))))).)))).}}}}}}.....,{{.({,(,((((....|},||||.(((({.....}}))),.}))).,,,,}{((.((((((..((((((((((....(((((..((((((((((((((((({,((((..(((((.....))))).))))..,,.,,...((((.(....}.)))).,,(((((.........)))))..,((((({{,.||,|||.......,|||}|,((((((((...,{{{....,((({({,{,{,,,{|,..,||||||,,,|,...,,)))}}|((((....,,||||,{{((((......)))))),,,,...........{((((,...,,)))}}..}}}}}}},,,))))))))))).}..}},.,,))))))).))))))))))))))))).))))),||||||},,{{{{{..{{{{{{{{{....{{{.(((((((((.{........,))))).)))).}}|,((((...}}||,,,..,,{{{((,,..}}},|((((.(({(({{,,,||,||,...||||,..{{({({,{{({.{{((...{..(((({,.,))))).,,}.))))}}....{(({,{{{{,,,|||||}||||}|}}||,,.,,..,,}}}||||,.,,....................{(((.(((.....))).)))).,,|((|{(((((((((((((.((....)))).)))))))..}}}},.||{{{{{{{...)))),)))),),,,)))}}))))}}|,.{{{{|,,,,,}})))}..,,}|||,...|||{,,,..||||||||..,,,{{{(((.,{....,..)))))))))|}|}}}..,,|||,|||}}}}})),))))})))..)))))).))}..........(((......))).{{{{|,,,.,,})))}.....((((((......)))))))))))}..))))))}{{{({...(((((((((((...((((((({,,,{,,(((....)))}||||,............))))).)))..))))))))))).,,.}))}})))).))))....}}))))).,.}}},,)))))))))))).))))))))).)))))}.))))))))..))))...}}}(((((.(((((....}))))....)))))(({|((,...)).}}},.....,,{((((.....))))}.))))}.....(((.....)))))).)))))),,)))}.})})...))))))))....,})))}}}}))))))))))),}))))))...)))).)).))))))).........{{{{(.,.,............,,...})))),.....))).)))))),................,,,)))))))))))))))..||{((((({..((((....)))).......))))).))}...{{(..(((.(((((((................)),}))))))).))|.....({({..((({.{{......))})))))))..,,....}.))))..))))..))))))).))))))......,))},,,,...,..|||||,{,.{(((,({(({{.......||}}..}))}...,,)))}}..,))}....}})},,,}|{{{{{....,||||||,,.((((((((.((((....((,{,(((((........)))))...,},},..))))))))))))...{((((((....))))))}((((((({,{(({.{........)}})),)}}})))))}.,,,,.....)))))))))).............||||||.}}}}}|}}...}}}))},,,.....,,}))))}|||.(((((((((((((..((((({(((((.(((((((,.{(,{..,,,{(................}}}}{((((((((...((((((((({(((({.,,....,|||||||,.,,,|||{{{{|{((,.,,....,,.},}}}}||,,..|}|,|.,,.......}}}}}}.,,)))}{((((((((.(((.,((,.(((((..(((.,(((,..,(((.((((((,,....,((((({(,.....}}}))}),,,)),....})))))))))))).,)))....)))))..}))..))).))))))))}.....}))))...))}}}))))}.(((((.((((.((.((((({.{.((....)),,)))))}......}}.)))).})))}.((((((((((....(((((((({{..(((((.{((,(({..,,...,}}.}}},(({{{{{|,,..,,,,,}}}}}))),,)))))....}}..)))))))))))))))))).......{(((((.{{((....))))..))))))......))))))))))..))))))......,.,(((((((..,.(({((,(,.,,,,.,}}}}}{{{{{{|||}..,,))}))}}}}}..{(((((((((.......((....)).......)))))).)))|((((((((.((((.{..........}.))))...))))))))}...)))))))}.,...{(((((((...(((..(((((...)))))...,|,(((,{((((.{{{,,......)}}..)))))}},..},,)))...)))))))){(((((.......)))))})))))..))),}))))))))).,,})...,,,,,,...((((({{{(((((..{{((,,..}},,....}}}....|,((((({.,,{{{({.(((((((...(((((((,..........,(((((((...((((((...((.,,,........(((((((,.((((.(((((((({,{{...,,,,.......)))))))).))))}...,,,...,....,,...((((..((((((((({....})))).,{,((((((((.....{{{((((.....))))}.,))..)))))))).,|{((((((..((((.((((.....)))).)))).))))))|((((.(((((...{,....).)))))))))}))))).))))...,}}.|||,................))))))).............,,...((((({..(({..{{{{,....,}}}.....,,...............,))).,))))))....||,{{......})))}..((((.....))))..,,.((((((((({{(,........})),.}))))}})))},.))))))..)))))))))))))))...)))))).}.)),})),},,.)).)))).........))))))))))))...)))))))))))..))))))))},....(((((.,(({....(((((...........))))).......)))..)))))....,.,)))).},...))))))),)}.,.))).....))))))))))..,{(((((((((........)))))))))....,}|{{((((((({{{.(((....))).,,.}))))))).,...}),})}}))})..,,{{{{||,|{|,||{.{{{{,.,.}}}}})).))),},)}}))}}...))))))}..............,....

Transcripts

ID Sequence Length GC content
AUAGAGAGAUUGGUUUUCUUUCUCUCAGCAUCUCCACCCAACCAGCAGA… 9068 nt 0.4230
Showing 11 to 11 of 11 entries
Summary

This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase, and this interaction is important to proper microtubule function in the developing cortex. Mutations in this gene cause abnormal migration of neurons during development and disrupt the layering of the cortex, leading to epilepsy, cognitive disability, subcortical band heterotopia ("double cortex" syndrome) in females and lissencephaly ("smooth brain" syndrome) in males. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]

Forensic Context

A study in mice demonstrated that long-term caffeine treatment in the Tg4-42 Alzheimer's disease model ameliorated hippocampal neuron loss and behavioral deficits while increasing the number of DCX-positive neural progenitor cells in the dentate gyrus, indicating a promotion of neurogenesis [Stazi et al. DOI:10.1007/S00018-021-04062-8].