Basic Information

Symbol
DDB1
RNA class
mRNA
Alias
Damage Specific DNA Binding Protein 1 Xeroderma Pigmentosum Group E-Complementing Protein UV-Damaged DNA-Binding Protein 1 UV-Damaged DNA-Binding Factor DNA Damage-Binding Protein 1 DNA Damage-Binding Protein A HBV X-Associated Protein 1 XPE-Binding Factor DDB P127 Subunit UV-DDB 1 XPE-BF XAP-1 XAP1 Damage-Specific DNA Binding Protein 1 (127kD) Damage-Specific DNA Binding Protein 1, 127kDa Damage-Specific DNA-Binding Protein 1 UV-DDB1 WHIKERS DDBA XPCE DDBa XPCe XPE
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001923.5
Sequence length
4245.0 nt
GC content
0.5213

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1513.60 kcal/mol
Thermodynamic ensemble
Free energy: -1587.90 kcal/mol
Frequency: 0.0000
Diversity: 1303.26
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.....(((.((((((((.(((((((((((((.....)))))).)))))))(((((.(((..((......))..))).)))))......((((((.(((.(((((((...)))..))))..)))..))))))(((((((.((...)).)).)))))((((((((.((((((((....)))).).)))...((((((((((((((((((((((.......(((.(((...((......(((((((((...))))).))))......))))).))))))))))).......(((((.(((((...(((((((...(((((((.((((((((((.((((((.((((((((((((((((((((((((......))))))...((.((((((((((..((((.........))).)..)).)).)))))))).(((((((((((((((..(((((((.(((((.......(((((.((((.(((((.((((((((...((((....)).))...))))))))......((.(((((((.(((((..(((((((((...((((((.(........).))))))...)))...))))))....((((...((((.(((((((((((.......))))..)))))))...((((.((.(((((.........))))).))..))))((((((((((((..............))).))))).)))).((((((....((..((.....))..))))))))..))))...)))).(((((....)))))))))).)).))))).)).......))))))))))))))(((((((((((.(((.(.....).))).)).)))))))))......))))).)))))))((((((.((.((((...(((((((((((((...))))))))....((.((....)).)).........((..(((((..(((....)))..)))))..))))))))))).))))))))....(((((......))))).((((((((((..((......))..))))).)))))..(((.......)))......(((((((........)))).))).......))).)))))(((((.....)))))..(((.((........)).))))))))))...))).))))..(((((((((((((...(((((.....(((.((.......((((((.((.(((((((((((((.(((((.(.(((((((((((.....))).))))))))..).))))).)))..((((((((.((((...)))).)).))))))....)))))...)))))))..))))))...)))))....))))).)))))))))))))(((((.((.......)).))))).............))))))))))).)))))).))..))))))))(((.....)))....((.((((((((........((((((((((.(((...((.(((.((((......)))))))))))).)))))))))).......((((..((.((...((((.((.(((((((((((((((((........(((((..(((.....)))..)))))..(((((((....((((.(((((((.((((((.(((((.((((.....)))).)))))..)))))).........((((((.(((((.......)))..))..))))))..)))))))...))))..........)))))))..(((.(((((........((.((((((....).)))))))((((((((((....(..(...(((.((.((.(((((........))).)).)))).)))...)..)....)))))))))).....((((((((.((.......)).))))))))))))).)))..))))))))..))))..)))))))..))))...))))..)))).(((((((.(((.....((((((((..((......))))))))))....))).)))))))((..(((((.....)))))..))...((((((.....)))))))))))))).))((((........)))).)))))))....((((........))))..((((.....))))))))))).))))).)))))...))))))))......)))))).(((((((.((..((((........))))((((....))))..........((........))((((.(((((((((((((((((.(((((((((.((.((((.((.((((((.(((((....).))))(((....)))((((((....((((((..((((((...((((((.(((..((((.(((.(((.....((((((((.....(((....)))...((....))....((((((((...((((((((..((....))..((((.....)))).))))))))...)).))).)))..((((.(((((.(((((((((.....))))(((..(((..(..........)..))))))((.....)))))))..))))).)))).......)))))))))))))))))).)))..))))))....)))))))))))))))))).((((((((((((((.((((((((......((((....(((((..(((((((((....((((((((((((...(((.((........))..)))..)))))..(((.((.....(((((((((.......((((((..........((.((((.....)))).))....(((((((((((((((.....((.....)).....)))))))))).)...))))..)))))).........))))))))))).))).)))))))...))))).....)))).)))))..)))))))))).)).))))).....)))))))))...)))))).)).)))).))..((((((.((..((((((..((((.....)))))))).))..)).))))))))))).)).))..))))))).(((((....((.((((....((((((.((((..(((((((...((((((.(..((....))..).))))))..((((((((((((((((((((((((((.((((((.............)))))).((((((((((.....((((.....(((((.......)))))((......))....(((((....)))))(((((.((((........)))).)))))...))))))))))))))..........((((.......))))....((((......))))......)).)))))))))))))).....))))))))))))))))).)))))))))))))).))....)))))....)))))))))).)))).)).))))))).)))).)))).......))))))))))))))))(((((((((((.............(((((((((((.(((.(........).))).))))..(((((((.....)))))))(((((.(((((..........)))))..((((((((((((.((((((..((...))..))))))....))))).)))))))...))))).......))))))).....(((...(((((....)))))...)))((((..(((((...(((((.........)))))...)))))..))))((((.(((((((((((((.((..(((((((...)))))))...))..)))))))..))))))..)))).....)))))))))))....((((((.......))))))..)))....((((((((((((((((((((.(((((((......(((.((((((..((((((.(((((((((.(((((((((........)))))))))..)))))((.(((((((((.(((........)))..)))))))))..))(((.(((((((((((((((((....((((((((((((((........))))))))))))))....)))))).))))))))))...).))).(((((((....)))))))(((((........))))).((((((.....))))))....((.(((...)))))))))))))))))))))))).))))))).).)))))))))))...........))))))))............(((((..(((((((........)))))))...)))))...
Thermodynamic Ensemble Prediction
((((((({.,,,((((,((((((((.{((((((((((((,...,)))))).))))))}(((((,(((.{((...{({((({|||,|||,|,,,,.{({(,,,}|||.||,....{{{((((((,,..{{((({(,,{,{{{,{{...,,,||||{{{...(((......}}},}}}||||},..||||.{,(((((({,{..,.....,|,(((....(((........)))....)))....,{(..(((((...))))).))))))))}}))}|,}||||}}}}))))}))...(((({.(((((...((((((({{,(((((((,{(((((({({.((((((.(((((((((({{((((((((((((......)))))),..((.(((((((((({{,(((.........))).)},}).}).)))))))).{((((((((((((((..(((((((.({(({..,,,..{{((({(((({.,(((.((((((((...((((....)).))...)))))))).{({..(((((((({{({{{,(((((((((...,))))))}|.,..,))).})),,.......,......))))).}}}.,,,|{.,,,|}((((((({{((,,,...,)))),.)))))))...{(((.((.(((((.........))))).)},.))))||{{,||||}||}}}}}.,,......}}}.}}})),|||||(((,.,....|||.,||...,,{({||((|({{..||,|...,|||.(((((....)))))|||||||||}||..||||||.}}}}))})))),}))}}|{{{{{{((((.(((.{.....|,||}.}}.}})))))))......))))|,}}}})))((((((.((.{{({{{,,{(({((((((((...)))))))),||,(,,({....)),}}..,....,.{{,.||||{|,|{{..,,))},.))}}}.,))))))}}}}).}}))))))....(((((......))))).((({((((((,,(|......))..))))))))))).}|||,...,,.}}).|||,|(((((((........))))},}},,.})}}))),)))))(((((.....)))))..{((,{{||,,....}},))}))))))}...})).)))}..(((((((((((((...(((({.,,..|,|.||,.,....|||{{{.{(,((((((((({(((,(((((.{,((((({(((((.,,.,|}|.}}}|||}},,|.}}|||.}}}..{(((({{(.((((...)))).)}.)))))},,..})))},,|))))))},,}}}}}}...}}}}},,,.})))).}))))))))))))(((((.((.......)).))))),...,..,..,,,))))))))))}.)))))).}}.,}))))}}|{{{.....}}||{,,((.((((((({...,,...((((((((((.(((...((.{(,{((((......)))))}})}))).))))))))))..{{,..{(((..((.((..,{{{{.|{,(((({((((((((({,,...,,,.,{,,,({{(((.....,||{.{||||...((((((....({{{.{{{{((|,|(((((.,,{((,((((.....|||)|)))))..)))))},,..,,.,,||||{{.{.{((.,,,...))),,},..))))}}..)))}))).,,}}}},.......,{||||,}},,{((...,,...}}}..,((.((((({....}.)))))})||,,,||||||,}|||}},..(((.,({..((((,({(((({(({{,..{,|{{,.||,...,.......)))},,,)))}}}}.)))),)))),,}}..})),}}))))|))),.,}}}})}.,}}}}|})},,}}}},,}))))|}..)))},,,}))},.)))},{((((((.({(...,,((((((((..((......))))))))))..,,))).))))))},|..(((((.....)))))..}}...((((((.....))))))}})))))).)),,,{|,.,,|,,}||,.|}}}}}}....((({........))))..{{{{.....})))))))))).))))).}))))..}))))))))..}}}.)))}))))},,{{{{((..((((........)))){(({,,,,)}}}....,,},,|,((((..,..{{((((.(((((((((((((((({.(((((((((,{{,((((.{{.((({{(,(((((...,},,}}|(({....}}}((((((....((((((..((((((...((((((.(((..((((.(({,(((...,.((((((((.{,,,(((,.,.||}...((....))..,.||||{{||,,.((((((((..((....))..((((.....}))).))))))))...}}.}}}.}}}..((((.(((((.(((((((((.....)))),,,..,,,..{..........,..}}}}}}{{.....}})))))..))))).))))..,....)))))))))))))))))).)))..))))))....)))))))))))))))))).((((((((((((((.{{((({(({{{{..,,(({...|||{,..|||||||||.,{,(((({((((({{...,,..||}},.,}}}))..||,,.|||,,..,,,.||}....|{{(((((({.....{((,(((...(((((((....))))))}})).)}).....|||||||((((((((.,...((.....)).....))))))))||{|{{{||||,.,}}}},.........}}})||||}||.,}|||}}}}}}.,,))}})..,..}})),)))))..,}}}})))))}))})))))}}}..)))))))))...}}}))}.)).}})).)}..{(({{|.||.,||||||..{{{{...,,)))))))),}),,)).,})))}))))).)).)}..))))))),(((((....((.((((...,((((((.((({..(((((((.,.((((((.(..((....))..).)))))).,((((((((((((((((((((((((((.(((((,,,,,,....,,,.}}|||}.{(((((((((,....((((.....(((((.,....,)))))((......))....(((((....)))))(((((.((((........)))).)))))...}))))))))))))),,........((((.......))))....|||{......)}))......)).)))))))))))))).....))))))))))))))))).)))))))))))))).))....))))).,.,)))))))))).)))).)},,..)))).}}...)))))}.....))))))))))))))))|((((((((((.........,...(((((((({{(,(({.{,...,,,,},})}.}}}}..(((((((.....))))))){(({(.({{{,.,.,....,.}}}))..((((((((((((.((((((..({...))..))))))....))))).)))))))...})))),},...|)))))))...,((((...(((({....}))))...))))|{((((((((...(((((.........)))))...}))))}}|(..((((.((((({{((..{.{{,{{..{((.(((,...}))).}),}}}.}},}..))))))))..))))..)}.))))))))))}....((((((.......)))))),||}|{{{{(((((((((({{{||{{|||.,{(((((......{{|,{(((((..(({((({(((,(,({(.(,((((({({{,,....}}}}}}))},.))))).))}||||{{{{.{{{........))).,))))}}}}}|||||||||((((((((((((((((....((((((((((((((........))))))))))))))....))))))}}))))))))),,,.,.{{{(((((((....))))))),)))|...{{,,.|}},,|(,((((.....)))))).,}}})))),.,.))))))))))))))))))))}}}).))))))}.|,||||||||}}}..,,,,,,,,,)))))))),...,,,,.,,.{((((..(((((((........)))))))...))))}...

Transcripts

ID Sequence Length GC content
GGCCUGCAACGUGUCUCUGGGGCGGAGGCAGCGGCAGUGGAGUUCGCUG… 4245 nt 0.5213
Summary

The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]

Forensic Context

A review of human studies identified the DDB1 as part of the ubiquitin-associated proteolytic pathway and found it to be associated with aging in the Framingham Offspring cohort [Solovev et al. DOI:10.1016/j.mad.2019.111192].