| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUACACGCUCGGCAGCUGCGGGGAGCCCGGCAGCCACGCUCUCCGGC… | 2142 nt | 0.6942 |
Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. The mouse studies revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons. The alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes the alpha2C subtype, which contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the ADRA2C is a gene marker highly expressed in cavernosal trabecular smooth muscle cells (CCSMC) and its expression is upregulated in patients with diabetes mellitus erectile dysfunction [Zhao et al. DOI:10.1038/s41467-022-31950-9]. Further comparative analysis between human and rat corpus cavernosum confirmed that the ADRA2C is a specific marker for human CCSMCs, but its expression was not detected in the rat model [Yin et al. DOI:10.1016/j.celrep.2024.114760].