Basic Information

Symbol
DDIT4
RNA class
mRNA
Alias
DNA Damage Inducible Transcript 4 REDD-1 REDD1 RTP801 Dig2 Protein Regulated In Development And DNA Damage Response 1 DNA Damage-Inducible Transcript 4 Protein HIF-1 Responsive Protein RTP801 FLJ20500 DNA-Damage-Inducible Transcript 4 HIF-1 Responsive RTP801
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation Mechanical injury analysis

MANE select

Transcript ID
NM_019058.4
Sequence length
1744.0 nt
GC content
0.5803

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-702.80 kcal/mol
Thermodynamic ensemble
Free energy: -736.34 kcal/mol
Frequency: 0.0000
Diversity: 551.14
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.(.((((.((((.(.(((.((((((..(.((((((...((((((.((((((.((((((((.((((......))))........((((((.....))))))...((((((..(((.....)))..))))))(((....(((((..(((...((((.....)))).....)))..)))))..))).......)))).)))).)))))))))))))))))).).)))))))))).)))).)))).).)).)))......(((((((((....((((((((((.((((((((((.((..((.(((...(((.((((((.((.(((((((((((((.(((...((.(((((((((..((((((((((.(((.((....)).)))..(((((((((........(((((.((((.(..(((((....))))).......((((((((((((.((.((((........)))).).).))..)))).))))))..).)))).))))).((((.((((((((..((((.......))))(((.((((((((..((((.........)))))).)))))).)))........))))))))))))....(.((((((((((((..(((((((.....((((((...((((.....))))((((.....))))..((.(((((((((((((.........)))).)))..))))))))))))))...))))))))))))))..)).))).)..)))))))))....))))))))))...))).))).......(((((((((((((((((....)))))...((((.((((.(((.(..((((.((....))..))))..).))).))))))))....(((((((..(((((((((((...(((((.(((....((((((.((((.(((((........((.(..(((..(((((((........))))))))))..))))))))))))......(((((((...........)))))))....(((((.((((((((((......)))))....(((((...)))))((((((((....)))))))).((((.......))))...(((((((.(((((..(((..((((..((((((.....)))))).))))...))).))))).))).))))...........(((((((.((........)).).))))))......(((((((...))))))))))))))).))))))))))).))))).....)))....))))))))))))))).))))))))))))))).))..)))))))))).))))))......((((((((((((....)))))).((((((((((.((.(((((((.(((..........))))))))))..))..(((.((((...))))))).......))))))))))....))))))((((....((((((((((((((((((......)))))))))))))..........))))).....))))....)).))))))))).)))))..)).))).)))))))))))........))))))..))))))))).(((.((.(((((...))))).)).)))..((((((((....((.(((((((...((((((.(............).))))))...)))......)))).))....)))))))))))..........................(((((....)))))
Thermodynamic Ensemble Prediction
(((((..((({,(((((,,((((((((,((((((((.,,||||||,,,||{{|||||,{{||||,|}.}||}|}}))}}.)))....,{(({(((({{{{{,||||}},,.{({({{..{||,,.,,)))..}}))))|||,,,..(((({{,{({{{(({,{,,,,||||,....||.,,}||||{{|{.,......{|{{{{,|,..,||(((((((((,{{.((.(.(((((((((((((,,(((((({{((((((.(...{((((((((((((((((..((((.(((((((.(.((((.(((((({(.((((((((((({...}}}((((...))))..((((((..(((((((..((((((((((,(((.((....)).)))..(((((((((........(((((.((((.{{.(((({....|}))).,,.,|,((((((((((,,.,,,||{(,.....{,|,,,.)}).}}.,)))).)))))).,,.)))).})))),(({((((((((((|,((((.,,,...|}||{((,((((((((,.{(((..,,..,,.}|||,||||||||.|}}........})}))))))))},,,,|,({{(({((({{{..{||{{|{.|}}.||{||{,},|{||..,,.))))||||..,|,||}}..|{,(((((((((((((.........))))},))}.})))))},}}))))}}.)))))))))))))),,)).))).,..)))))))))..,.)))))))))).,.})).))))....))))))))))))))).))..}}.))).).)))).).))))))).}.)))..)))|.{,.((((..{(.{(((((.{.....,).)))))}.))..)))){||{{{{{{,,}}))},}{{{.(((((((....).)))))),.,}.(((......)))....))))))))))}),...).)))))).},,))))).,...{{(((.((((((.....(((((({,.(((((...))))).,}{(((((.,,.((({{{((((...(((((...)))))((((((((....))))))))))))))))),}.})))}}},|,,,,,.((((,..(((..((((..((((((.....)))))).))))...))).})))){((({{{.{{{{........(((((({.,{,.....,,}),}.)))))}..,.{.(((((((...))))))).}.{{{,.((((......))))...))..)))).)))))))))))))..)))))).)))))}))))))))).))).).))))))))))))),,,,.....|||((((((....))))))}}}}|||||||,||.(((((((.(((..........))))))))))..}}.,|,|,||{,...)))))),,,.,,,,|||}}}}},}),,)}}})))}),},..}}}))|(((((((((((((......)))))))))))))..........,.)))))).))))){((({((((((((((,.{{{{,,{((.,..})}...)),}),.)))))))))))....(((.(((({......))))}}))}.(((((((((,,,..{(((((((....((.(((((((.,.((((((.{...{....,,..}.)))))).,.)))......)))).))....)))))))),)}.........,}))))))}..}}||}.,{{{|,,..)))),

Transcripts

ID Sequence Length GC content
GCAGCAGGCCAAGGGGGAGGUGCGAGCGUGGACCUGGGACGGGUCUGGG… 1744 nt 0.5803
Summary

Predicted to enable 14-3-3 protein binding activity. Involved in negative regulation of TOR signaling and response to hypoxia. Located in cytosol. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans demonstrated that the DDIT4 mRNA, identified as a candidate marker for time-of-day prediction from whole transcriptome sequencing, exhibited a peak expression at 08.00h and a valley at 20.00h [Gosch et al. DOI:10.1016/j.fsigen.2023.102915]. Quantitative PCR validation in dried blood stains showed this marker maintained significant differential expression between peak and valley time points in fresh stains, but this significance was not retained in stains stored for one week at room temperature, highlighting the impact of storage conditions on its forensic applicability for estimating the time-of-day of bloodstain deposition. A study in humans demonstrated that the mRNA of the DDIT4 was significantly upregulated in salivary extracellular vesicles from emergency department patients with acute head trauma compared to healthy controls (p=0.0203) and also showed a significant difference in expression between these acute patients and those from an outpatient concussion clinic (p=0.0243) [Cheng et al. DOI:10.1002/jcp.28139].