| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGCAGGCCAAGGGGGAGGUGCGAGCGUGGACCUGGGACGGGUCUGGG… | 1744 nt | 0.5803 |
Predicted to enable 14-3-3 protein binding activity. Involved in negative regulation of TOR signaling and response to hypoxia. Located in cytosol. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans demonstrated that the DDIT4 mRNA, identified as a candidate marker for time-of-day prediction from whole transcriptome sequencing, exhibited a peak expression at 08.00h and a valley at 20.00h [Gosch et al. DOI:10.1016/j.fsigen.2023.102915]. Quantitative PCR validation in dried blood stains showed this marker maintained significant differential expression between peak and valley time points in fresh stains, but this significance was not retained in stains stored for one week at room temperature, highlighting the impact of storage conditions on its forensic applicability for estimating the time-of-day of bloodstain deposition. A study in humans demonstrated that the mRNA of the DDIT4 was significantly upregulated in salivary extracellular vesicles from emergency department patients with acute head trauma compared to healthy controls (p=0.0203) and also showed a significant difference in expression between these acute patients and those from an outpatient concussion clinic (p=0.0243) [Cheng et al. DOI:10.1002/jcp.28139].