Basic Information

Symbol
ADRB1
RNA class
mRNA
Alias
Adrenoceptor Beta 1 ADRB1R Adrenergic, Beta-1-, Receptor Beta-1 Adrenergic Receptor Beta-1 Adrenoreceptor Beta-1 Adrenoceptor B1AR BETA1AR FNSS2 RHR
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_000684.3
Sequence length
3039.0 nt
GC content
0.5877

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1253.00 kcal/mol
Thermodynamic ensemble
Free energy: -1308.89 kcal/mol
Frequency: 0.0000
Diversity: 863.53
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......((((...(((((((((((.((.(((((((((((.(((((....((((((((((.(((((((((((((..((((.((((((((((((.(((.(((((...((((.......))))(((((((((((...(((.....)))(((((((........))))))).........(((((......((((...((((....(((((((...........(((........))))))))))..)))).))))...)))))...)))))))))))((((((((((.....))))))))))))))).)))...))))))..((((((.(((........))).)))))).((((...)))))))))).))))..)))))))).)))))))))))))))..(((((((.(((.((.((((.(((((((((.((....)))))))).))).)))).))..(((((((((.....)))))).)))))))))))))....((..(((((((.......)))))))..))))))).))))).........................((((((((((((.(....)))))))).))))))))))).)).)))).)))))))(((((...))))).((((((((((((..(((((((((.......).))))))))..)).)))))).(((((((.((......))))))).))...))))((((...((((((.(((((((...((((((((...(((((...((((.((....(((((.......(((.((((((((((((((((..((((((((((...(((((.....)))))))))))...................)))).)))((((((((.((.(((((((((((.(((((.(((...((........))(((((((((((.(((((.....(((....)))........((.(((((.......))))).)).....(((.((..(((((.((((((((....))))...)))))))))..)).)))))))).)))).))).))))...(..(((((......)))))..).)))))))))).)))))...)))).)))))))))))))))))))))))))).(((((((...(((((((((((..(((((((((((.((((((.(((((((...(((((((((((...((....)).)))))))...(((((((((((((.((((..(((((.((.((.(..((((((((.((.((((((....)))))))).))).)))))..).)).))))....((((((((((((.........(((.(((((((((...(((..................))))))))...)))).)))))))))))...))))........)))(((((((.((...((....))...))..))).))))....)))).)))))))))))))(((..(((((...))).))..)))...(((((.((((((...((((.((.(((((((((..((....))))).(((.((((((...)))))).)))(((((((......))))))))))))).)).))))))))))..))))).))))..))))))).)....))))))))))))))))...(((.((((........)))).)))((((....((((((((((.((...)).)))))..))))))))))))))))))))..)))))))..)))))...)).))))))))).((.((((((((.....)))).(((((((((.((((((((((((.((..(((.((((.......((((.(((..........))).))))((.((.(.((((........))))).)))))))))))..)))))))..))).)))))))))))))..............(((((((((((.(((((((((..............((((((((.((((((..((..((..(((..(((((((((((.(((((((..(((((..((((.((...((((........))))...)).).)))..))))).))))))).))(((..((((((.(((((..((.....((...(((....)))..))...))..))))).)))))).)))(((.((((..(((((..............(((((((.(((((...))))).......)))))))((((((((((((((((((....((((.....))))....))))))).)))....))))))))((((.((((.(((.(((..................((((((((((..((...))..))))))))))..)))))))))).))))...))))).(((....))).)))).))))))))((((((....))))))(((((........)))))..((((((....))))))...((((((((.((.(((((...)))))))))).)))))))))..)))..))..))..))))))..(((((((.....))))))).((..((((...))))..)).))))))))....))))))))).))))))))))))))).))...(((((((((((((((...........((((......(((((((((.......)))))))))......)))).(((.........)))(((.....)))((((((.(((((((((((.((((...((((((((((((((((((((((((((..............................)))))))))....((((...((((((...))))))...))))))))......)))))))...(((((((.......))).))))...................))))))...)))).)))))))).))).)))))).)))))))....))).))))).((((.(((((.(.((((((((..........((((.(((...))))))).)))))))).).)))))))))......)).))))))...))))))).).)))))..))))......))))...
Thermodynamic Ensemble Prediction
.......((((...(((((((((((.((.(((((((((((.(((((....((((((((((.(((((((((((((..((((.(((((((....((((,.(((,{,..{{({..|{{{|||{|({({....(((...)))...||||||{|||,|||.,..,,))})}|||,.........|||}..,.{{{{({((((((({.{((((....))))}.....{((,,,(,,,.||.,((((((((((((({{({.......)}.})),..))))).))))))).,.}..,}))))}}}.,,))))))))......}}}|,.((((((.(((......}.))).)))))).}|))))))})))))))).))))..))))))))))})))))))))))))..(((((((,(({.{({((((.(((((((((.((....))))))))))}).)))).,,||{((((((((.....)}))}),}},))))))))))....{{..{(((({(..,,,,.}}})))).,))))))).))))),{,.,..........,,,.......((((((((((((.{....}))))))).))))))))))).)).)))),,))))))(((({...))))).((({((((((((..(((((((((.......).))))))))..)),)))))).{((((((.((......))))))),}}...)))|(,(({{.((((((.(((((((.,.(((({{{(((.(((({,,,((((.((....(((((.......(((.(((((((((((((({,..,.(.((((((...(((((.....))))))))))).,.....||||........},,,.))}|(((((({{((.((((((((({(,(((((.(((...,,........}}(((((((((((.(((((....((((....||....}}|..{{.(((((.......))))).)}.....(((.((..((((,{((((((((....))))...)))))))))..)).))}))))).)))).))).)))).|,{.,(((((......))))).,,,))))))))))))))))...)))).))))))))}))))))))))))))))).(((((((...(((((((((((.((((((((((((.(((((({(((({((,.(((((((((((((..(((..(((((.{(((,,.}|||((((((((((,((((,.(((({.{{.((.|..((((((((.((.((((((....)))))))).))).)))))..}.}}.}})}....({((((((((((.........(((.(((((((((...(((..................))))))))...)))).))))))))))).,,}},,........}}}(((({((,{{...((....))...}}..))).)))),}},))}).))))))))))}||{{(..(((((...{{{.{{..,{{...||||.}|||}||}.|||||,(({((({,((((,{((....,.}},..,|,|}|}}})}}},)))),)}.(((((((,.....)))))))))))).})).))))))))))))),}|}.,||,..}}}}))),}...,))))))))))}))))).}.||{.((({.,,,,,,,||||.||}((((...,|||,.||{||,|{..,)).))))}..)))}}}))))))))))))))..)))))))..))))}...}},)}}}||||}.,||,{({{{({.....},}}.|{{{|||||,{{{||||{{{|||{{..(((,{{{{{...,..((((.(((..........))).)))),{,||.|.,,,,..}}....},}))}}}})))))))},.)))))},..,}}.))}||||}|||||{{{{{{{{.,.,,.(((((((((((.(((((((((..............{(((((,(.((((((..((..((..(((..(((((((,,{|{(|{{{{{..{{,,..,(((((,(({.{,(,{{{{{{..{{{{{{{{,.,.)),..)))))})))))).},},}|}..||||||(((((,,(({..{{(.(({(,,......|{,,,.}}}|{.|||||{||||||{|||{({...,({......},.,,..}}.}.}}||||,,..(((({...})))).......|{{{,{(((((((((((((((((({.,{{(({,.....,))}..,,))))))).)))....)))))))))).))}|||}|||,|||..................((((((((((..((...))..))))))))))..,)))),))))})))))))}((({.((({{.......))))),.})))}((((((....))))))(((((........)))))..((((((....)))))).,,||{,||||,,,((((((...))))))))}}.},}))}))}..)))..))..))..)))))).}{||||||,,,.,|||}}||,{(.,{,.,.,||||}...,.,))}))),,,..))))))))).))))))))))){((((.(((....))).}}.}}|}}}..,}}}.}}}}}}},....,|{(((((((.......)))))))}}((((((((((((..........,,.((((.((({,{{{{{(((,((({{((((((,,{{{.|||||||{{(((((((((((((((((({,............................,,,)})))))..,,((({...((((((...))))))...}}}}}}}},.,...,))))}}},.|{(((((.......))},)|}|{..{{,,..,...,,}}..})})))}.,))))}))}}}}}}.))).))}}}}}}|,,{{{,{{{{|{,||||..,{{..|}))},..}}))}}}}}}.,}.,,,)))),))}},,.{((((((((....)))).))))).,,))))).))))))))))).,.))))))).).)))))..)))),.....))))...

Transcripts

ID Sequence Length GC content
AGAAACAUGCUGAAGUCCCGGCGGCUCUUCCAGCAGCGGCAGCGGCUCC… 3039 nt 0.5877
Summary

The adrenergic receptors (subtypes alpha 1, alpha 2, beta 1, and beta 2) are a prototypic family of guanine nucleotide binding regulatory protein-coupled receptors that mediate the physiological effects of the hormone epinephrine and the neurotransmitter norepinephrine. Beta-1 adrenoceptors are predominately located in the heart. Specific polymorphisms in this gene have been shown to affect the resting heart rate and can be involved in heart failure. [provided by RefSeq, Sep 2019]

Forensic Context

A study in mice demonstrated that the ADRB1 mRNA was significantly upregulated in ante-mortem burned skin compared to controls, a finding validated by RT-qPCR [Liu et al. DOI:10.1007/s12024-022-00474-5]. Separately, a clinical study in severely burned adult patients found that the ADRB1 gene expression was significantly increased in subcutaneous white adipose tissue at 1-3 and ≥10 days postburn compared to healthy controls, identifying it as the highest expressed β-adrenergic receptor that may drive burn-induced tissue remodeling [Knuth et al. DOI:10.1097/SLA.0000000000005880].