| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUCUGGAGACUCAACAUGAAGCUACCGGCCAGGGUUUUCUUUACUCUG… | 3400 nt | 0.3956 | |
| GUUCUGGAGACUCAACAUGAAGCUACCGGCCAGGGUUUUCUUUACUCUG… | 2760 nt | 0.3786 |
Enables 2 , 4-dienoyl - CoA reductase (NADPH) activity; NADPH binding activity; and identical protein binding activity. Involved in fatty acid beta-oxidation. Located in cytosol; mitochondrion; and nucleoplasm. Part of catalytic complex. [provided by Alliance of Genome Resources, Jul 2 0 2 5]
A study in humans evaluated candidate reference genes for normalizing qPCR data in an analysis of gamma-hydroxybutyric acid (GHB)-induced gene expression in blood, where the DECR1 was assessed as a candidate reference gene but was not selected as a top normalizer [Mehling et al. DOI:10.1007/S00414-017-1609-3]. Another study in humans, developing a targeted mRNA panel for forensic age estimation from blood, incorporated the DECR1 as one of nine reference genes in the initial primer design for stable expression and included it in the final primer pool of seven reference genes [Hänggi et al. DOI:10.1016/j.fsigen.2025.103282]. A study in mice demonstrated that the DECR1 was commonly up-regulated in liver tissue following Kupffer cell-specific and endothelial cell-specific exposures to α-particles, as well as after neutron exposure, as part of a broader inflammatory response characterized by altered gene expression profiles [Roudkenar et al. DOI:10.1269/jrr.07078]. In a separate investigation in rats, the DECR1 was identified as a metabolism gene involved in fatty acid oxidation and was significantly down-regulated in liver tissue on day 4 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].