Basic Information

Symbol
DECR1
RNA class
mRNA
Alias
2,4-Dienoyl-CoA Reductase 1 SDR18C1 DECR 2,4-Dienoyl-CoA Reductase [(3E)-Enoyl-CoA-Producing], Mitochondrial Short Chain Dehydrogenase/Reductase Family 18C Member 1 2,4-Dienoyl-CoA Reductase 1, Mitochondrial Short Chain Dehydrogenase/Reductase Family 18C, Member 1 2,4-Dienoyl-CoA Reductase, Mitochondrial 2,4-Dienoyl-CoA Reductase [NADPH] 4-Enoyl-CoA Reductase [NADPH] 4-Enoyl-CoA Reductase EC 1.3.1.124 NADPH
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Chronological age estimation Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_001359.2
Sequence length
2760.0 nt
GC content
0.3786

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-678.70 kcal/mol
Thermodynamic ensemble
Free energy: -734.10 kcal/mol
Frequency: 0.0000
Diversity: 697.20
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((..(((...)))..)).))...((((((.......))))))(((((((((((((((((.((((((........))))))..((((((((((..........(((((((...((((((((...(((((((((.........((((((((((.......((((((((..(((...........)))....))))))))........))))))((((((((((((((...(((..((.......))..))).))).))).)).))))))))))...((((..((((((....(((((((..........)))))))....))))))....)))).....))))...))))))))))))))))))))......((((((((((.......))))))))))((((......))))..(((....)))..((((((.....))))))(((.((((((......))).))).)))..........(((........)))...))))))))))..((((((.....(((...))).....)).))))..((((((.......))))))....((((.....(((..(((((((......(((((.(((((..(((.((((((.(((((((((((....((((...(((((......)))))))))..)))))).))))).))))))..)))...).)))))))))....)))))))..)))..)))).......))))))........(((...)))......)))))...))))))....)))))...((.((((((((((((..((((...((((((.((...))))))))))))..(((((...(((((((..(((((........))))))))).))))))))((((((.(((((..((((.......))))((((.(((((..((((((.(((((((............))))))).)))).))..((.((((.(((((....(((((..((..((.(((((((((.((((((...............(((..((((((((((.(((...((((((..(((.((((......)))).)))..))))))((((......))))(((((.((((....................))))...))))))))))))))...))))..)))(((((((.((((.............)))))))))))..........................(.(((((((.(((((((((((((((......)))))))))).(((.(((((((((((((((((((((((.((.......((((..(((.((((((((...((((((..(((((((..((.......))..)))))))...............(((((....)))))(((.....((((..(((((((.((((.(((..((((((.((((.((((((((((((((.......((((((((((((....((((((((.((((((((((((((((((((((((......(((............))).(((..........)))........))))))))))....((....)).)))))))...........(((((((....))))))).....((((((((....))))))))((((((....((((((((........))))))))))))))...)))))))))))))))....((((((.....))))))(((..((((..........))))..))).)))).)).))))))((((.....))))))))).....))))))))).....))))...)))))).))).)))).)))))))...))))......))).((((......))))))))))...(((........))).))).))))).)))))))......)).))))))))))....)))))))....((((.((((.((.........((((((((...............)))))))).........))..)))).))))..(((((((......)))).)))))))))))).....(((..(((.(((.(((...(((((.((((..........((((((((..(((((.((((((...)))))))))))))))))))(((((....(((((((((...((((..........)))).)))))))))...)))))..........)))).)))))....)))))).)))..)))))))).))))))).)...................((((.(.((((((....)).)))).).)))))))))).)).))..)))))))..))..)))))))))))))).))............(((((...)))))...............((((((((.(((.(.(((.((...)))))).))).)))))))).......(((..((((((((((((((((((((((..(.((((..(((....)))..)))).))))).)))..(((....))).......(((((((((......(((((.....)))))((((((((....))).))))).((((....)))).......))))))))).)).))))))).............)))))))))....)))))))))........(((((.....)))))..))))).)))))).(((((...................))))).....(((((.((((((....)))))))))))..........))))))))))))))
Thermodynamic Ensemble Prediction
(((((((((..(({...})).,}}.,,,,|((((((.......))))))(((((((((((((((((.((((({,,,,,..,|}|}|,..((((((((((..........(((((((,..{(((((((,,.{(({{{{{{.........,,((((((((....,..((((((((..(((...........)))....))))))))..,,....))))))||(((((((({(((...(((..((.......))..))).))).))).}}.))))||||||...((((..((((((.,..(((((((..........)))))))..,.))))))....))))..,..,,))}},)))},))))))))))))))).,({{{((((((((((.......)))))))))){{{{,,,,..}|||..{((....)))..{(((((.....))))))(((.((((((......))).))).))).......,},(((........)))...))))))))))..{{{{{{.....(((...)))...,,}}.}}}}..{(((((.......)))))}....|{{{...,||||,.(((((((......(((((.(((((..(((.((((((.(((((((((((....((((...(((((......))))))))),.)))))).))))).))))))..)))...),}))))))))....))))))),,,||..}})),.},...})))))........,{{..,))}......)))))...))))))..,,)))))...,{.((((((((((((..((((...(((({{,((,,.|},|||||}}||,,((((,...{{{,{||,,{||||..,,,,..)}})))))}.||||||,|{{{{{{.{||||,.((((.......)))){(((((((((,,(,,{{{.(((((((............))))))).))}}|,,..{(,((({{(((({....{{{((..{,..{{.{(((({{{{.,{{{{|,,,,..|},.,{..((((..((((((((({,(((...((((((..(((.((((......)))).)))..))))))((((......)))),,{{,.,,...,,,,........,{,..,,)},,,}}},}},}))))))))...))))..)))},,||{(,((({.............})}}}}}}},|{{{{....................,}}}|(((((({((({((((((((((({....,))))))))))}{{{.{(((({((({(((((((((((((.((,,.....{{{|||{((,((((((((...((((((,.((((((({{,({....}},)},))))))).,.............(((((....)))))(((.,{{,((((..(((((((.((((.(((..((((((.((((.(((((((((((((({....,,{{{{{{{|||||....((((((((,((((((((((((((((((((((((...,,.(((............}}|.......,,|,,..}})...,,...))))))))))....((....)).)))))))...........(((((((....))))))).....{(((((((....}})))))}((((({....{{{{{{{{........}})))))})))))},,})))))})))))))))....((((((,...,)))))){((..((((,{,.....}}))))..))).}))).)).}}}}}}||.,.....,,},))))).....))))))))).....))))...)))))).))).)))).)))))))...)))).,.)},))).((((......))))))))))...(((........))).}))},}))).))))))}......)).))))))))))....}}))}}}....|||{.{|{|,{|.......,,((((((((,,.....,,......)))))))).}))},}..))}.,||,,||},.{(((((((......)))).)))),}}))),),,........,{{.,.(((((((,((((,,{{({{{.....,,,((((((((.,(((((.((((((...})))))))))})))))))){{{{{.,,.(((((((((...((((,,......,.|})).})))))))),}.))))},,,.})))}.))))))),,,....))}}}},))},,,,,})))).)}}}}}},}...................,,.{.(,((({{(,,,.}|,}}}}.,.,,,,}}}})).)),))..))))))),.}},,)})))}}}}}}))},)).,,.........(((({...}))))..,,,......{{,,((((({{{.,{{,{{{,{,||,..,.||||||||{||||}}}}.......{((..((((((((((((((((({((((..(.((((..(((....)))..}))).})))).))).{(({....))).......(((((((((......((({{.....}}}}}((((((((....)))},)))).{(((,...,)))}......))))))))).}}.)))))),............,)))))),,..,,.)))))),}}........{((((.....)))))..))))},||},,},,,|||,.||||||.....,,,,,}}))}}}},,.{((((.((((((....))))))))))}..,.......})))))))))))),

Transcripts

ID Sequence Length GC content
GUUCUGGAGACUCAACAUGAAGCUACCGGCCAGGGUUUUCUUUACUCUG… 3400 nt 0.3956
GUUCUGGAGACUCAACAUGAAGCUACCGGCCAGGGUUUUCUUUACUCUG… 2760 nt 0.3786
Summary

Enables 2 , 4-dienoyl - CoA reductase (NADPH) activity; NADPH binding activity; and identical protein binding activity. Involved in fatty acid beta-oxidation. Located in cytosol; mitochondrion; and nucleoplasm. Part of catalytic complex. [provided by Alliance of Genome Resources, Jul 2 0 2 5]

Forensic Context

A study in humans evaluated candidate reference genes for normalizing qPCR data in an analysis of gamma-hydroxybutyric acid (GHB)-induced gene expression in blood, where the DECR1 was assessed as a candidate reference gene but was not selected as a top normalizer [Mehling et al. DOI:10.1007/S00414-017-1609-3]. Another study in humans, developing a targeted mRNA panel for forensic age estimation from blood, incorporated the DECR1 as one of nine reference genes in the initial primer design for stable expression and included it in the final primer pool of seven reference genes [Hänggi et al. DOI:10.1016/j.fsigen.2025.103282]. A study in mice demonstrated that the DECR1 was commonly up-regulated in liver tissue following Kupffer cell-specific and endothelial cell-specific exposures to α-particles, as well as after neutron exposure, as part of a broader inflammatory response characterized by altered gene expression profiles [Roudkenar et al. DOI:10.1269/jrr.07078]. In a separate investigation in rats, the DECR1 was identified as a metabolism gene involved in fatty acid oxidation and was significantly down-regulated in liver tissue on day 4 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].