Basic Information
MANE select
Secondary Structure
Secondary structure that contributes a minimum of free energy.
Thermodynamic properties of the Boltzmann ensemble.
Structure Prediction
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCCUUGCUAUAGAAGACCUGGGACAGAGGACUGCUGUCUGCCCUCUC… | 494 nt | 0.5223 |
Summary
Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 3, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 1 by only one amino acid. This gene and the gene encoding defensin, alpha 1 are both subject to copy number variation. [provided by RefSeq, Oct 2014]
Forensic Context
A study in humans demonstrated that the DEFA3 gene, part of the antimicrobial peptides pathway, was upregulated in the prefrontal cortex, hippocampus, kidneys, and colon of sepsis patients [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. In a separate forensic investigation, the DEFA3 was represented by the DEFA1B marker in a screening of candidate mRNA markers from the GTEx database for body fluid identification, though it was not selected as a final specific marker for any single fluid type [Lin et al. DOI:10.1016/j.fsigen.2025.103376].