Basic Information

Symbol
DEFA4
RNA class
mRNA
Alias
Defensin Alpha 4 HP-4 DEF4 Defensin, Alpha 4, Corticostatin Neutrophil Defensin 4 Corticostatin HP-4 HNP-4 Defensin, Alpha 4, Preproprotein Corticostatin HP4
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_001925.3
Sequence length
587.0 nt
GC content
0.5009

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-187.20 kcal/mol
Thermodynamic ensemble
Free energy: -198.38 kcal/mol
Frequency: 0.0000
Diversity: 129.88
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((((.......((.((((.....)))).))...(((((.((((.....(((((((((((.(..((.((.((((...(((..(((..(((((.........)))))(((((((......)))))))......)))..)))))))))))..).)))).)).))))).))))...)))))))))))))))..((((..((((...((((.(((.(((((((((..(((.(((.......))))))((((....(((((((((((.(((((((((((((((((....))))))))...((((....(((((......)))))....)))).)))))).)))...((((((...))))))...((((((.((((((.((...(((((((.((.....)))))))))...((((...((((((((...)))))))))))).))))))))...)))))))))))))).)))...))))......(((((.(((......))).)))))..))))))))).)))...))))...))))))))....((((((...(((...............)))....))))))
Thermodynamic Ensemble Prediction
...((((((((((,......,{.((((,,...}}}}.||,.,||{{{{(((((.{{((,({(((((((.((((({((.,(((......}}|....(((({.........)))))(((((((......)))))))))),,))))..)))))))},.......)))}})})),),.,)))},,))))}))))))))))..((((..((((...((((.(((.(((((((((..(((.(({.......))})))((((...,(({((((((((.{{{((((((((((((((....))))))))...{(((.,..(((((......}))))..,,)})}.)))))).}}}{{{{(((((...))))))}},((((((.((((((.((...(((((((.((.....)))))))))...((({..,((((((((...)))))))))))).))))))))...)))))))))))))).})).,.)))).....,(((((.(((......))).))))).,))))))))).)))...))))...))))))))....((((({...{({...............}}}....))))))

Transcripts

ID Sequence Length GC content
AUGGCUGCUCUUGCUACAUAAGACCUGGAACACAGGACUGCUGUCUGCC… 587 nt 0.5009
Summary

Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several alpha defensin genes are clustered on chromosome 8. This gene differs from other genes of this family by an extra 83-base segment that is apparently the result of a recent duplication within the coding region. The protein encoded by this gene, defensin, alpha 4, is found in the neutrophils; it exhibits corticostatic activity and inhibits corticotropin stimulated corticosterone production. [provided by RefSeq, Oct 2014]

Forensic Context

A study in humans analyzing blood samples from burn patients identified the DEFA4 as one of 19 center genes commonly differentially expressed across early-stage, middle-stage, and control comparisons, indicating its association with burn injury progression [Wu et al. DOI:10.007/s10753-018-0829-0]. Subsequent research confirmed the DEFA4 as a key immune-related gene, finding it significantly up-regulated in burn patients through bioinformatics analysis and validation via an external cohort and qRT-PCR on clinical blood samples [Niu et al. DOI:10.1093/jbcr/irad050].