| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUGGCUGCUCUUGCUACAUAAGACCUGGAACACAGGACUGCUGUCUGCC… | 587 nt | 0.5009 |
Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several alpha defensin genes are clustered on chromosome 8. This gene differs from other genes of this family by an extra 83-base segment that is apparently the result of a recent duplication within the coding region. The protein encoded by this gene, defensin, alpha 4, is found in the neutrophils; it exhibits corticostatic activity and inhibits corticotropin stimulated corticosterone production. [provided by RefSeq, Oct 2014]
A study in humans analyzing blood samples from burn patients identified the DEFA4 as one of 19 center genes commonly differentially expressed across early-stage, middle-stage, and control comparisons, indicating its association with burn injury progression [Wu et al. DOI:10.007/s10753-018-0829-0]. Subsequent research confirmed the DEFA4 as a key immune-related gene, finding it significantly up-regulated in burn patients through bioinformatics analysis and validation via an external cohort and qRT-PCR on clinical blood samples [Niu et al. DOI:10.1093/jbcr/irad050].