| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAUAUCCACUCCUGCUCUCCCUCCUGCAGGUGACCCCAGCCAUGAGGA… | 454 nt | 0.5110 |
Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several of the alpha defensin genes appear to be clustered on chromosome 8. The protein encoded by this gene, defensin, alpha 5, is highly expressed in the secretory granules of Paneth cells of the ileum. [provided by RefSeq, Oct 2014]
A study in humans demonstrated that the DEFA5 is highly expressed in small intestine tissue, with an average read count of 165,872, and was part of a targeted 46-plex mRNA panel for definitive organ identification using massively parallel sequencing [Hanson & Ballantyne DOI:10.3390/genes8110319]. A review further notes the DEFA5 is an established mRNA marker for intestine tissue identification in forensic transcriptomics, highlighting its role in tissue and body fluid tracing applications [Lei et al. DOI:10.1093/gpbjnl/qzag007].