Basic Information

Symbol
DEFA5
RNA class
mRNA
Alias
Defensin Alpha 5 HD-5 DEF5 Defensin, Alpha 5, Paneth Cell-Specific HD5(20-94) Defensin-5 Defensin, Alpha 5, Preproprotein
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_021010.3
Sequence length
454.0 nt
GC content
0.5110

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-142.40 kcal/mol
Thermodynamic ensemble
Free energy: -149.00 kcal/mol
Frequency: 0.0000
Diversity: 89.26
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........(((..(((((...(((((..((((((..(((((.((.((.((...((.......(((((((......)))))))...)).))))))))))).)))))).))))).)))))....)))(((....((((((.....)))))).........((((((((((((((((.....(((((...(((.((((.(((.((.((((((...)))))).)))))))))))))))))....((((...)))).((..((((.((((.(((.....)))))))((.((.(((.((((((((.((.............)).))))))))..))).)).)).........))))..)).))))..))..)))))))))).....(((((.((((..(((.....)))....)))).)))))...........................)))......
Thermodynamic Ensemble Prediction
.........{((..(((((...(((((..((((((..(((((.((.((.((...({.......(((((((......}))))))...)),))))))))))).)))))).))))).))))).}..}}}(({....((((((.....)))))){{{{{,...(((((((((({{{{({.....(((((...(((.((((.(((.((.((((((...)))))).)))))))))))))))))....(({(...||||,{{(((((({((({.(((.....)))}}))}}},|,|,,.{|||||||,|{.||....{.,...}}.))}))})),,||}.,},},.,........}}}},)},})}}..}}..)))))))))).....(({{{.((((..{((.....))}....)))),))))}......................,,...}})......

Transcripts

ID Sequence Length GC content
ACAUAUCCACUCCUGCUCUCCCUCCUGCAGGUGACCCCAGCCAUGAGGA… 454 nt 0.5110
Summary

Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several of the alpha defensin genes appear to be clustered on chromosome 8. The protein encoded by this gene, defensin, alpha 5, is highly expressed in the secretory granules of Paneth cells of the ileum. [provided by RefSeq, Oct 2014]

Forensic Context

A study in humans demonstrated that the DEFA5 is highly expressed in small intestine tissue, with an average read count of 165,872, and was part of a targeted 46-plex mRNA panel for definitive organ identification using massively parallel sequencing [Hanson & Ballantyne DOI:10.3390/genes8110319]. A review further notes the DEFA5 is an established mRNA marker for intestine tissue identification in forensic transcriptomics, highlighting its role in tissue and body fluid tracing applications [Lei et al. DOI:10.1093/gpbjnl/qzag007].