Basic Information

Symbol
DEFA6
RNA class
mRNA
Alias
Defensin Alpha 6 DEF6 HD-6 Defensin, Alpha 6, Paneth Cell-Specific Defensin-6 Defensin, Alpha 6
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_001926.4
Sequence length
465.0 nt
GC content
0.4882

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-143.60 kcal/mol
Thermodynamic ensemble
Free energy: -150.92 kcal/mol
Frequency: 0.0000
Diversity: 114.95
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((.(((((((((((((.........((.......))..((((....)))).((((((((..(((((((.(((..(((((.....))))))))..)))).......))))))))))).....(((..((((..(((((...)))))..)))))))))).)))).)))))).)))...(((((((((............((((((..(((((...(((((((.(((((...)))))....)))))))...)))))(((.((((.((((((((((((((....))))).....)))))))))...)))).)))(((....))).(((......))))))))).(((((((((((((((..........((((((......))))))......((((.((......)).))))...............)))))))..))))))))...)))))))))........
Thermodynamic Ensemble Prediction
.,,(,,{((((((((,,{,,,,.,,,,..((.......}}..{(((....)))}.((((((((..(((((((.(((..(((((.....))))))))..)))).......))))))))))).......,..((((..((((,...)))))..))))))))))})),)})}|||,..||,..(((((((((.....,{{{,..{{{{{{,.{{((({{({{{{....|||||},,|||||..,,|}}})}}...,}})||,|,||{{.((((((((((((((....))))).....))))))))),,,,}||{,||(({....})).|||},..})).,)))))).(((((((((((((((.,,.......((((((......)))))),,,...|||,.,{.,,.{{||{|,,,,}}}}}.},......))))))),.))))))))...))))))))).,,,....

Transcripts

ID Sequence Length GC content
ACACAUCUGCUCCUGCUCUCUCUCCUCCAGCGACCCUAGCCAUGAGAAC… 465 nt 0.4882
Summary

Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several alpha defensin genes appear to be clustered on chromosome 8. The protein encoded by this gene, defensin, alpha 6, is highly expressed in the secretory granules of Paneth cells of the small intestine, and likely plays a role in host defense of human bowel. [provided by RefSeq, Oct 2014]

Forensic Context

A study in humans demonstrated that the DEFA6 is a highly expressed mRNA biomarker for small intestine tissue identification, with an average read count of 114,731, and was part of a targeted 46-plex MPS assay that successfully identified tissue sources with high specificity and sensitivity [Hanson & Ballantyne DOI:10.3390/genes8110319]. A review further notes the DEFA6 as a documented mRNA marker for intestine identification within the field of forensic transcriptomics [Lei et al. DOI:10.1093/gpbjnl/qzag007].