| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACAUCUGCUCCUGCUCUCUCUCCUCCAGCGACCCUAGCCAUGAGAAC… | 465 nt | 0.4882 |
Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several alpha defensin genes appear to be clustered on chromosome 8. The protein encoded by this gene, defensin, alpha 6, is highly expressed in the secretory granules of Paneth cells of the small intestine, and likely plays a role in host defense of human bowel. [provided by RefSeq, Oct 2014]
A study in humans demonstrated that the DEFA6 is a highly expressed mRNA biomarker for small intestine tissue identification, with an average read count of 114,731, and was part of a targeted 46-plex MPS assay that successfully identified tissue sources with high specificity and sensitivity [Hanson & Ballantyne DOI:10.3390/genes8110319]. A review further notes the DEFA6 as a documented mRNA marker for intestine identification within the field of forensic transcriptomics [Lei et al. DOI:10.1093/gpbjnl/qzag007].