| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUGAAACUCCAUUCCCUUAUUUCUGUUCUCCUCCUCUUUGUGACUUUAA… | 240 nt | 0.4042 |
Defensins are cysteine-rich cationic polypeptides that are important in the immunologic response to invading microorganisms. The antimicrobial protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 8p23. [provided by RefSeq, Nov 2014]
A study in mice demonstrated that the DEFB130A transcript, an antimicrobial peptide, increased in abundance within one hour postmortem, exhibiting a profile with two distinct maxima over the experimental time course [Pozhitkov et al. DOI:10.1098/rsob.160267].