| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACUCAGCUCCUGGUGAAGCUCCCAGCCAUCAGCCAUGAGGGUCUUGU… | 337 nt | 0.4837 |
Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 4, an antibiotic peptide which is locally regulated by inflammation. [provided by RefSeq, Jul 2008]
A study in human skin demonstrated that the DEFB4A (DEFB4), an inflammatory/immune response gene, was significantly up-regulated in thermally injured tissue compared to normal non-wounded skin during the early wound repair process [Greco et al. DOI:10.1016/j.burns.2009.06.211].