Basic Information

Symbol
ADRB3
RNA class
mRNA
Alias
Adrenoceptor Beta 3 Adrenergic, Beta-3-, Receptor Beta-3 Adrenergic Receptor Beta-3 Adrenoreceptor Beta-3 Adrenoceptor BETA3AR ADRB3R B3AR
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_000025.3
Sequence length
2585.0 nt
GC content
0.6004

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1035.00 kcal/mol
Thermodynamic ensemble
Free energy: -1076.86 kcal/mol
Frequency: 0.0000
Diversity: 740.73
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((.(((((....((((.((((..((((((((.((......))...))).)))))...)))).))))((.((...(((((........))))).....))))(((((((((((((((((((((((((.((((((((((...((.((((.....)))).))..))))))..)).))))))).((((((((((((................))))).)))))))((((((.((.((((((((((((((((((((((.(.(((((..((((((((((((((((.((((((((....((((((...(((((((((((((((((.((...)).)))))..(((((.((...)).)))))..(((((.((((((((((..((((....))))......(((((((((..(((((((((...((((........)))).))))))))))))))))))))))))).))))))))((.....))..((((((.(((....))))))))).((((.((((((((.....((((.(((((((......((((((((((...(((((.....)))))...)))))))..)))(((((.....).)))).))))))))))).(((.(((((..((.(((((......))))).))..))))).)))..((((((((((((((...((.((.(((((((((((.(((...........))).))))))))))).)).)).......))))))))))))))....................................((((.....))))..)))))))).)))))))))))))))).)))))).((((.....))))((((.(((((((((((..((((....((.(((((((((((.((((..((........))..)))).)))))))))))..(((((((.......)))))))))....))))..))))))))).)).)))).))))))))))).......((((((..........))))))......(((((((..((.....))..)).))))).......))))))..))))))))))))..).)))))))).....(((.(.((((..((....))..)))).).)))))))))).............((.........)).........((((((((..((((....((.(((.....))).)).....)).)))))))))).))))))).))..))))))((((.(((((.(((.(((((.(((((((..((((((((.(....((..(((.(((.(((((.(((.((((..(((...)))...)))))).).))))).))).))).)).....).))))).)))..))))..(((((....))))).......(((((((.........(.((((((((((.....(((((..((((.......((((.((..((((.....((((((...(((.((.((((((..........((((((((........(((((((((.....(((((((..((.....))..))).))))..............((((.((((((((((........))))).))).)).))))((((.(((((((((((((((...((((.(((...))))))).)))))))).))))(((.(((((((.(((..((((.((((((((((((((((((.....((((((((.(((......((((..((((.(.....).)))))))).((((((((..(((.((((((..((((((((((.((((((.........))))))...))))...))))...(((((((....)))))))))..)))))))))..))))))))...(((..((......))..))).))).))))))))....)))))......))))))))...(((((((......)))))))................))))).))))..)))................))))))).)))......))).))))..............................))))))))).......))))))))...((((.(((........)))..)))).......)))))).)).)))..((((((..........................))))))....)))))).(((((((.(.((((..((..........))..)))).).).))))))(((..............)))........))))..)).))))......))))..))))))))))))))).))))))))))).))))).))).)))))))))..(((((((((((((....)))))))....(((((......)))))))))))...)).)).)))))))).).).))).))).((((.(((((.((((((....)))))).)))))..))))((...(((((((..(((((((..((((.......))))...))))))).)))))))...))....))))).)))))).....................((((.((((...(((...............)))..)))).))))..
Thermodynamic Ensemble Prediction
((((.((.(((((....{(((.((((..((((((((.((......))...))).)))))...)))).)))}((.({...(((((........))}}}.....}))}|{{((({,((((((({{({{(((((.(({(((({((,,.{{.((((.....)))).))..}}}})),,)),))))))).((((((((((((.....,..........))))).)))))))((((((.((,(((((((,{{{({{((((((((.(.(((((..(((((((((((((({(.((((((((....((((((...(((((((((((({{(((,{(,,,}|.}|||},,(({(({{{..,||{|||||....{{{,(((((((((({.({({{,,,||||....,.(((((((({.{(((((((((...((((.,.....,)))).))))))))))))))))))))}}|||.}|}}}|||{{,,{{{|,{{((((((.(((....))))))))}.{{{{.{{,{{((({{,.,((((.(((((((.....,((((((((((...(((((.....)))))...))))))),.}))||{{|,,,.,),))}}.})))))))))).}))}|||||,,||||{(({,...,.}}))),)|{{|||||{,,|{,((((((((((((((...((.((.(((((((((((,{((...........))),})))))))))).)).)).......))))))))))))))}.........{....................},}}}||||.....}},,.,))))))))})),,)))))))))))).)))))).((((.....))))((((.(((((((((((..((((..,,((.(((((((((((.((((..((........))..)))).))))))))))),.(((((((.......)))))))}).},,))))..))))))))).)).))}),})))))))))).....,,{(((((.,........)))))}......(((((((..{{.....})..))}})))).......))))))..))))))))))))..).)))))))).....{{{.{,((((.{(({...,}..||},.|{|,||||,}|}....}},,.,,,.||.........}}.........||||{{||}}||||...,(({(((.....}||.},.....)}}}})))))))).))))))).))..))))))((((.(((((.(((.(((({.((({{{(,{(({(((((,(....||..|||,(((.(((((.(((.((((..(((...)))...)))))).).))))).))),))),||,,,,,},}||}},.)).,)))),,|,,,,..,{||}},..}}},.(((((((.........(.((((((((((....,(((((..((((..{{(.(((((,,((((((({{(....(((...}}}..,..((((.,....|.}}}},((((((........((((,((((((....(((((((..((.....))..))).))))......)))))),..,})))....,,,,}}}}}}...,)))).))))))}),}.)))).))}(({{((((({(({{.((((.(((...))}}}}).},))))}))))})}}{{..((((((((..,{,{(.(((((((((..(((((((.....((((((((.(((......((((..((((.{.....).)))))))).,,,{,((((...(((((((((((.(((({(((.{{((((,,,...,,,}})))).,,))))...)))).....)))))))),})).,.)))).,.........{((((|...})))))..{,......,}..,}..))).))))))))....)))))))....{((|{,,,.,((({{,,,..{{.{||||||,....(((.(((.....))).)))....((((.(((({{{......}}),.}))).)))))}}}}}),)}}}},)}},,,,,},,,....))))))))},}.,,,..))))))))..,,......{{{{{{.((({(((,{({{{,,|{{({{{|....,,{{||,},,.,{,{{,.((({((..,,.....,,,,,..........,,)))}}}.,|},..))).|||||||,|,|||{..{{,,........}).,)))).,...}}}}}}.,|...}}}},}}},.))))}}}}....))))})})}})}},.)),.))))..))))))))))))))).))))))))))).})))).))).)))))))))..,{{(({(((((((....)))))))||,,(({((....,.})))}}}}}}},.,)),})}))))))}),).),)}),}||{{({{,(((((.((((({....}))))).))))),,||},.}),,(((((((..(((((((..((({.......))},...))))))).)))))))...,,....))))).)))))).....................{{({.((((...(((...............)))..)))).})))..

Transcripts

ID Sequence Length GC content
GGGACAGCUAGAGAAGAUGGCCCAGGCUGGGGAAGUCGCUCUCAUGCCU… 2585 nt 0.6004
Summary

The protein encoded by this gene belongs to the family of beta adrenergic receptors, which mediate catecholamine-induced activation of adenylate cyclase through the action of G proteins. This receptor is located mainly in the adipose tissue and is involved in the regulation of lipolysis and thermogenesis. Obesity and bodyweight-related disorders are correlated with certain polymorphisms in three subtypes of beta-adrenoceptor, among them, the ADRB3 gene.[provided by RefSeq, Oct 2019]

Forensic Context

A study in human burn patients demonstrated that the ADRB3 gene expression in subcutaneous white adipose tissue showed no significant changes postburn, except a signal towards an increase at 1-3 days [Knuth et al. DOI:10.1097/SLA.0000000000005880]. A scoping review of human twin studies reported that increased mRNA expression of the ADRB3 in human umbilical vein endothelial cells was negatively correlated with birth weight [Dany Laure Wadji et al. DOI:10.1371/journal.pone.0315549].