Basic Information

Symbol
DIO3
RNA class
mRNA
Alias
Iodothyronine Deiodinase 3 Thyroxine 5-Deiodinase TXDI3 Deiodinase, Iodothyronine Type III Selenoprotein DIO3 Type 3 DI DIOIII 5DIII Thyroxine Deiodinase Type III (Selenoprotein) Iodothyronine Deiodinase, Placental Type Type 3 Iodothyronine Selenodeiodinase Type III Iodothyronine Deiodinase Type-III 5' Deiodinase EC 1.21.99.3 EC 1.97.1.11 EC 1.97.1 ITDI3 D3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001362.4
Sequence length
1958.0 nt
GC content
0.6067

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-838.80 kcal/mol
Thermodynamic ensemble
Free energy: -870.75 kcal/mol
Frequency: 0.0000
Diversity: 288.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((((((((..((..((((.((((((((((((.(((((.(((((..((((((((...(((((.((.......)).)))))))))))))..((((((.....))))))...(((((..(((((((((((((..(.((((......((((((((((......((((((((((((..(((((..((..(((((((....)))))).)..)).(((((.(((.((...)).))).))))).....))))).))))......))))))))))))))))))....((..(((.(((......))).)))...))...((((((((.((((......)).)).).))))))).((((...))))((((........)))).)))).).)))))).))))))).)))))...)))))..(.((((((((((....)))....))))))).)......(((((..(((((..((((((((.....))))))))......((..(((.....((((((.((((...(((((......)))))....))))..))))))...))).)).)))))..)))))(((((((............)))))))))).)).)))))))((..(((((......)))))..))..))))).))....))..))..)))).(((((((((...((((((((..(((((((.......))))).))..)))))))))))))))))..((((((((((.....(((((((((((((...((((((....((((((((.((((......(((.(((((((((.....(.(((..((.((((((.(...).)))))).)).))))....)).))).))))))).))))))))).)))...((....))..)))))).))))(((..(((((....)))))..)))........(((((..(((((((((((((.(((((....)))))))))).))......(((((...((((((...)))))).)))))..((((.(((....)))))))..)))))).))))).(((((........)))))............((((((((((((((((.((((((((...((.((((.(((.........(((((...(((((..(((.....)))..))))))))))(((((((........).))))))..((((((((.......(((.((((.(((((((.((((((.(((((((((((......((((((..(((((((..(.(((.....))).).)).)))))..)))))))))))((((((((.......((((.(((((.(((((.((((((((((...))))))..)))).))))).))))).)))).))))))))(.((((....)))).).((....))(((..((((((..(....)..))))))..)))........))))))))))))..(((((((.((((((((.(..(.(((((((((....(((.(((.((((.(((...((((((.(((....((((....)))).))).))))))...)))))))))).)))......))))))))).)..).)))))))).)))))))((((.((....)).)))).((((......))))....((((((((.((((....(((((....(..(((.((((...)))))))..)..))))))))))))))))).....))))))).))))))).))))))))...))))))).))...)))))))).))).....))))).))))))))((((.((((((((......)))))..))))))).))))))))).....((((((...........)))))).........)))))..)))))(((....(((.((((....)))).))).....)))......................)))..))))))........
Thermodynamic Ensemble Prediction
...((((((({(((((..((..((((.((((((((((((.(((((.(((((..((((((((...(((((.((.......)).)))))))))))))..|||||{..,,,||||}}...(((((..(((((((((((((.,(.((((......((((((((((......(((((((((((({,(((((..((..{((((((....)))))).}..)).{((((.(((.((...)).))).))))},,...))))))))))......))))))))))))))))))....{(..(((.(((......))).))}.,.,}{{,((((((((.((((......)).)).),})))))),|(((...)))}((((........)))).)))),).)))))))))))))).)))))...,))))},|,((((((((((....)))....))))))).}......(((((..(((((..((((((({.....})))))))......((,.{{(,....((((((.((((...(((((......)))))....))))..)))))}...,}}.}).)))))..)))))(((((((............)))))))))).)).)))))))((..(((((......)))))..))..))))).))....))..))..)))))(((((((((...((((((((..(((({{(,,,....}}))),)),.)))))))))))))))))..((((((((((.....(((((((((((((...((((((..,.((((((((.((,,...,{.(({{((((((({{.,,..(.(((.,((.((((((.{...).)))))).)).)))}..,,)}.))).))))))).))))))))).})).}.((....))..)))))).))))(((..(((((....)))))..)))........(((((..(((((((((((({,(((((....)))))))))}.,,....|.(((((...((((((...)))))).)))))..((((.{({....})))))),})))))).))))).(((((........)))))............((((((((((((((((.((((((({...((.((((.(((.....,...({{{(,,,(((((..(((.....)))..)))))}))))((({(((........).))))))..((((((((.......(((.((((.(((((((.(((((((((((({(((((......((((((.,(((((((..(.(((.....))).).)).))))).,)))))))))))((((((((.......((((.(((((.(((((.((((((((((...))))))..)))).))))).))))).))))})))))))){.((((....)))).}.{{....}}{{{,.,,((((.(((((....))))))}.))......,},))))))))))))..(((((((.((((((((.(..(.(((((((((....(((.(((.((((.(((...((((((.(((....((((....)))).))).))))))...))}))))))).)))......))))))))).)..).)))))))).)))))))((((.((....)).}))).((((......))))....{(((((((.((((....(((((....(..(((.((({...}))))))..)..))))))))))))))))}.....))))))).))))))).))))))))...))))))).)).,.}))))))).))).....))))))))))))))(((({,(((((((......)))))..))))))).))))))))).,,,.((((((...........)))))).,,......)))))..})))){({.,,.(((.((((....)))).))).....))}.,,,.................,)},.,))))))........

Transcripts

ID Sequence Length GC content
AGAUGCCUCGCCAGGCCACGUCGCGGUUGGUGGUCGGAGAGGGCGAGGG… 1958 nt 0.6067
Summary

The protein encoded by this intronless gene belongs to the iodothyronine deiodinase family. It catalyzes the inactivation of thyroid hormone by inner ring deiodination of the prohormone thyroxine (T4) and the bioactive hormone 3,3',5-triiodothyronine (T3) to inactive metabolites, 3,3',5'-triiodothyronine (RT3) and 3,3'-diiodothyronine (T2), respectively. This enzyme is highly expressed in pregnant uterus, placenta, fetal and neonatal tissues, and thought to prevent premature exposure of developing fetal tissues to adult levels of thyroid hormones. It regulates circulating fetal thyroid hormone concentrations, and thus plays a critical role in mammalian development. Knockout mice lacking this gene exhibit abnormalities related to development and reproduction, and increased activity of this enzyme in infants with hemangiomas causes severe hypothyroidism. This protein is a selenoprotein, containing the rare selenocysteine (Sec) amino acid at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, May 2016]

Forensic Context

A study in human postmortem nucleus accumbens tissue demonstrated that the DIO3 was represented on Affymetrix U133 microarrays but was not consistently detected in the examined samples [Michelhaugh et al. DOI:10.1111/J.1471-4159.2010.07126.X].