Basic Information

Symbol
DKK4
RNA class
mRNA
Alias
Dickkopf Wnt Signaling Pathway Inhibitor 4 Dickkopf-Related Protein 4 Dickkopf-4 HDkk-4 Dickkopf (Xenopus Laevis) Homolog 4 Dickkopf Homolog 4 (Xenopus Laevis) DKK-4 Dkk-4
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_014420.3
Sequence length
896.0 nt
GC content
0.5179

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-309.00 kcal/mol
Thermodynamic ensemble
Free energy: -323.76 kcal/mol
Frequency: 0.0000
Diversity: 179.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((...(((((((.(((((((((((.......))))))(((((.((((.....)))).))))).........).))))..(((((.(((......))).)))))((((((......))))))((.((((....)))).)).((((.(((((.(((....)).).))))).)))).((((((((....)))))))).((((((((((((.(..(((((((((..((((.(((...((.((((..((((.......((((........)))).(((((((((((((....))))))....(((..(((((...))))).)))....((((....))))(((((.(((((((((((.(.(((........))).).)))))))))..)))))))..((((((......((((((..((((((.((((((((...)))).........(((((((.(....).)).))))).))))..........))))))...))).)))...)))))).)))))))..((.....((((((.....)))))).....))....((((((((.(((..(((((....))).))..)))....((((.(....((..(((((((.......)))))))..))...)))))((.(((.((.((..(((((.......)))))..))..)))))))..))))))))))))..)))).)))))))))..))))))....)))..).)))).))))))))......(((((.(((((....))))).)))))...(((.(((((......)))))))).))))))).((((((((......))))))))......((((.....))))......(((........)))...........))).....
Thermodynamic Ensemble Prediction
......,((,,,(((({({.{..,.((((((.......)))))){((((.((({.....}))).)))))...........)),)}}||||,.{{{,,...,|||,,}|}|((((((......)))))}((.{{((....)}}},||,((((.(((((.{((....)).).))))).)))).((((((((....)))))))).((((((((((((.(,,({(((((((..(({{{(((...((.((((..((({.......{(((.,....,.)))}.(((((((((((((....))))))..,,(((..(((({...})))).)}}....((((....))))(((((.(((((((((((.(.((({.....}.))).).)))))))))..)))))))..((((((......((((((..((((((.((((,(((...||)),..,...,,{((((((.{....).)).))))}.))))..........))))))...))).)))...)))))).)))))))..((.....((((((.....)))))).....))...{((((((((.(((..(({{{....,}}.))..)))....((((.(,...((..(((((((.......)))))))..)).},,))))((.({{{((.{(..(((((.......)))))..}}..))))))),.)))))))))}))..)))),)})))))))..))))))}...})),.).)))),,)))))))......(((((.(((((....))))).)))))...{||,||||{.|||..||}}}}}},)))}))).((((((((......))))))))......((((.....)))).....,{{{........)}}}..,,,,,...)),.....

Transcripts

ID Sequence Length GC content
AGACUUUGCUCAGCCGAUUUCACGCACCUUACUCAGACUAAGGUUUACU… 896 nt 0.5179
Summary

This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the DKK4 as a putative mRNA biomarker for vaginal secretion identification, where it was expressed at higher levels in vaginal secretions compared to saliva with an average 14-fold difference, though it showed cross-reactivity with saliva in 3 out of 15 samples tested, making it more suitable for a quantitative qRT-PCR assay format [Hanson et al. DOI:10.1016/j.scijus.2012.03.007]. A subsequent review further lists the DKK4 as a validated mRNA marker for the identification of vaginal secretions in forensic transcriptomics [Lei et al. DOI:10.1093/gpbjnl/qzag007].