| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACUUUGCUCAGCCGAUUUCACGCACCUUACUCAGACUAAGGUUUACU… | 896 nt | 0.5179 |
This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2. [provided by RefSeq, Jul 2008]
A study in humans identified the DKK4 as a putative mRNA biomarker for vaginal secretion identification, where it was expressed at higher levels in vaginal secretions compared to saliva with an average 14-fold difference, though it showed cross-reactivity with saliva in 3 out of 15 samples tested, making it more suitable for a quantitative qRT-PCR assay format [Hanson et al. DOI:10.1016/j.scijus.2012.03.007]. A subsequent review further lists the DKK4 as a validated mRNA marker for the identification of vaginal secretions in forensic transcriptomics [Lei et al. DOI:10.1093/gpbjnl/qzag007].