Basic Information

Symbol
DLG5
RNA class
mRNA
Alias
Discs Large MAGUK Scaffold Protein 5 KIAA0583 Discs Large Protein P-Dlg Placenta And Prostate DLG Disks Large Homolog 5 P-Dlg PDLG Discs, Large Homolog 5 (Drosophila) Discs Large Protein LP-DLG Discs, Large Homolog 5 Discs Large Homolog 5 Large Type Of P-DLG LP-DLG P-DLG5 YUVOB
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_004747.4
Sequence length
7644.0 nt
GC content
0.5740

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3002.30 kcal/mol
Thermodynamic ensemble
Free energy: -3126.05 kcal/mol
Frequency: 0.0000
Diversity: 1914.87
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((((((.((((((...)))))))))..((((((((((..((((((.(((....)))))))))(((((((..((((((((((((((((((.......((((((..(((((((((((((.(((((((((((((....(((((.(.((((.((....(((((.(((((((.(((....))).))))..))))))))))))))((((((((.((...)).)))))).))..).)))))..)))))))))))))...(((..((((.((((((....((((.(((((.((.(((((.(.(.....((((((..((.(((...))).))..))))))((..((((((....((((.(((((((((.(.(((((.((((((((((.....((((((((((((....(((.(((.((.((.((.((((((((......(((((((((((((((.(((((((((...(((((.......)))))...)))))........(((((((....)).)))))))))))))).....)))))))))).......).)))))))...)).)).))..)))..)))..))))))))))))(((.(.((((....)))).).)))..)))))).))))..(((((.(((.(((((........)))))..)))..)))))....))))).).))))))))).)))).....))))))..))..).).))))))).).))))))))))))))))))..)))..(((((((....)))))))......((((......)))).......)))))............(((((....((((((((..(((....(((((((.......))).....(((((((...))))))).(((((.((((...((((..((..........))..))))...)))).)))))((((......))))))))..))).)))))))).)))))...)))))))).)))))).((((((((((.((......)).))))))))))((((......))))..(((((((((((.((.(((((((.((((..((((((((((..((((.(((((.(....).)))))..))))...)))))).))))..))))............((((((((...(((.(((..(((((((((((.....((((((((((((.((.((((.((((..(((((((..((((((.........(((((.((((.(((((.(((((.(((((.(((.((...(((...(((((((........((((..(((((..(.(((....((((.((((((((((((((((((..(((((..(((((((((((.....((((...(((.....((.((.(((......))))).))))).))))...(((.((((((((.........)))))))))))....((((((..((((...(((.....))).....))))....).))))).......)))))).))).))..)))))(((((.....))))).((((((.....)))))).((.((((.(((....))).)))).)).))))))).).....))))..)))))).))))..)))...)..)))))..)))).......))))))).......((((((.((..((((((..(((......((((((......((.(((((((....((.....)).(((((((...(((((..((((((((..(((.....)))(((.(((......))))))(((..((((((..((.((...((((((((.((((((..(((.((((((((.........((((.(((.((.((............)).)).))).))))((......))(((((((((..(((.(.((((((((((((((((((.(((((((((..((((..(((...((..((((.((.((.((((..((..(((((.....)))))..))..(((.((.(((.((((((((((..((....))..)))))))..(((....((((((((((((.((((((.((.(((....((..((((((...))))))..))..))).)).))).)))...))))....(((........))).((((((((((((((.(((...((((..(((((((....(((((.((.((((((((.((((.((((.((((((.(......)))))))...(((...)))(((((((((((....(((..(((..((((((...(......)...)))).))...))).....)))...)))).)))))))....(.((((((...)))))).)((((((....)))))))))).))))......)))))))).)).)))))..))))))).))))..)))))))))))))..(((..(((((((((((.((.((((.....)))).)).....))))))))).))..)))...(((((..(......).))))).))))))))))))...)))(((((...)))))..))).))).))))))))).))..))))))..))...))).))))..)))))))))..)))((((.((((.....(((((....((((.((....)).)))).......((((((((...((((...(((((((.....))))))).))))......(((((((((((.(((((..(((((....)).)))))))).........)))))).....))))).....))))))))..))))).((((((((.((.((...(((((((((.((((((((((((((((((((((((.(((.((((.......))))....)))....))))))))......(((((((((....)))))))))..(((.....)))......))))).)))))))))((......))...((.(((((.((((((((.(..(((((.(((((((((..((((((....))))))....((((..(((.((((((.(((((((((((((.((((((...(((....(.(((..((((...(((.....)))..))))..))).))))))))).).)))))))))))))(((.(((((.(((((.....((((((.....((....))...((((((.................))))))........................)))))).....)))))))))).))))))))))))..))))....((((.(((.((((((((((.........))))......((((.....)))).(((((.....(((((((((....)))))).)))......)))))....))).)))))).)))).(((((((.(((((..(((....(.((.....)))....))))))))....))))))))))))))))..)))))....).)))))))).))))).)).)))))))))))....)).)).)))))))))))).)))).((((((.(.((....((..((((......))))..)).....)).).))))))..(((((((((((((.((.......)).....))))).))))))))))))))..)))))))))).)))..)..)))))))).)))))))))))..)))....((((((.(((...(((((..((((....))))))))).(((((((...)))))))))).))))))))).)))))))).)).))..((.((((.....)))).)))))))).)))))))))))...)))))))))))))))))))))))))))......)))))))))..))))))))...(((((......))))))))...))))).))))))))))...)))))....(((((.(((((...))))).))))).(((.((((((...((((....))))...))))))))).....))))..))))))))))).........((.((.(((....))).)))).))))))).))))..(((.((((((..(..((.((((...)))).))..).))))))..)))...........(((........))).)))).)).))))))).((((.((((((.((...(((((..((((...))))..)))))...)).(((......)))......((((...)))))))))).)))))))))..))))...)))))))..))).)))...))).))))).(((((.(...).)))))...(((((((.((.((((....((((((((.((...((((((((.((((((...((((((...)))).))..)))))).)).)))).))(((((((((((((((((((.........))))).))(((((((((..(((((((((((((((((((......)))).)))))..)))).......(.(((......))).)((((...((((((((((.((((.((((......)))).)).)).))...(((((((...((.((((...((..((((..((((((.((((((((((.....((((((((((((.......)))))))(((((((......(((((..(((((((((((.(...((((((((((.((((.((((.(((.....(((....((((((((..((..(.((((........)))).)..))..((((.((.((((((((.(((..((.....))..)))......))))))))...)).))))))))))))....))).))).)))))))).))).........)))))))...)))))(((((((.(((.((((((((((.((((((......(((....))))))))..).)))))).)))).)))))))))))))))))..))).)).((((.(((((((.......(((((((.(..((((.((.((...........)))).))))..).)))).)))..((((...))))((((((((((((((((..(((((...))))).....))))..)))))....))))))).))))))).)))))))))))..).)))).....)))))))).....((((....(((((.......)))))...))))......))))))))..))))..))...)))).))..(((((..(((..(((((..............)))))..))))))))......)))))))...........((((((((((((((.....)))).((((....)))).((((((.(.....).))))))...((((.....)))).((((((....)))))).......((......))...(.((((((((.((((.........)))))))))))).)((((((..((((((((..(((((.((((...((((((.(((..........))).))))))..)))))))))..((.((((((...((((((..(((.....(((((.(((((.((((.((....(((((...(........)...)))))..)).)))).))))).)))))...(((((.......))))).)))))))))...)))))).)).....((((.(((.((((.((..((...))..)).))))))).)))).(((((.((....)).)))))......)))).)))).))))))..........))))))))))..))))))))..))))..))))))))))).)))).............(((..(((((((((...........(((((((..((.(((((((((((((.(((.((((((.....(((((..((((((..(((((.((((((((..(((((.....(.(((((((((((.((((((...(((((((.....))))))).(((((.((.((....)).)).))))))))))).))))).....((((........)))).................(((((...)))))...))).)))))))))..).)))))))..(((((((....))))))).......))))).((((..((((((...((.(((((........))))).)).))))))...)))).......(((.(((((.(((..(((((((((.(((..(((((((.......((.(((((((((.((.(((((.(((((((((.(((....)))...((((.......)))).....((((......)))).............(((((((.((((.........)))).))))))).((((...........)))).((((.....)))).)))))....((..(((((((....((((....)))).))))..)))..)).....((((........)))))))).)))))..))..))))))))).)).....)).)))))))).))))))))).)))..))))).))).....))))))...)))))))))))((......))((((.((((((((.(((.....))).))))))))..)))).)))))))))))))))))).((......))..(((.((....))))).)))))))...(((((...)))))..(((..((((((...)))))))))..((((...)))))))))))))..)))..............((.....)))))))))))))).)))))))))))))).)).)))))))(((.((.(((.....)))..)))))))).)))).)).)))).))))))).))))).))))))....))))))).))))))).(((((...)))))((((((((((.....((((.....((((((((((.(((....((........))...))))))))))))).................))))))))))))))..(((((((..(((((((((((....))))))..)))))....))))))).(((((..(((((((.(((((((((.......)))))....(((.((((((((((((..(((((.......)))))......(((.(((((((...((((((.((.....))))))))..))))..))).))).)))))))))))).)))(((..(((((((....)))))))..))).....)))).)))).))).))))).(((((((((((...)))))).)).)))))))))))))........(((((((..(((((.(..(((....)))..).))))).............)))))))((((((...))))))...........(((((((((((((((......)).))))))..(((((((.(((........((((((.....))))))))))))))))..............((...(((((((.((((((......((.(((((((...((((((((((.....))).))))).)).....))))))).)).......)))))).((((.((((...)))).)))).)))))))....)).)))))))))).).))))))))).....((.((((((((........))))...)))))).((((...((((..(((((((((.(((((((((......)))))..))))...)))))))))..))))...))))...........
Thermodynamic Ensemble Prediction
((((((((({(((((,{((((({...}))))))))..((((((((((..((((({{(((....)))))))))(((((((..((((((((((((((((((.,,....((((((..(((((((((((((.(((((((((((((....(((((.({(,,{.((.(({((((,.(((((((((((((((({((...)))}})}))},.}))))|||})}}}.,))}),)))))}}}.,),.).)))))..)))))))))))))...{{{..((((,((({{({{,.(({,{(((((.((.(((((.(.(..{{{(({((({{(({.,,...))))|}||}|}}}}((..((((((.,..((((.(((((((((.(.(((((.((((((((((.....((((((((((((....(((.(((.(({,,.((.((((((({......(((((((((((((((.(((((((((...(((((.......)))))...)))))........(((((((....)),}))))))))))))).....)))))))))).......).))))))),,.}}.,)))...)))..)))..))))))))))))(((.{.((((....)))).).)))..)))))).)))),.(((((.(((.(((((........)))))..)))..)))))....))))).).))))))))).)))).....))))))..))..}.},))))))}.).))))))))}}})))}})).,)))..(((((((....)))))))......((((......))))....,,.))))),{......}},,{{({(,,.,((((((((,.,((((((...))))))..,|.,{,,.,{.{((((({...}))))))},(((({((({..,((((..,,.}}}},..,.)},.)))).{{||||,,|}||(,{,...,}})})))))))..},.}))))))).)}))),,.)))))))).)))))).{(((((((((.((......)).)))))))))|((((......)))),.(((((((((((,((,(((((((.{(((..((((((((((..((((.(((((.(....).)))))..))))...)))))).))))..))))|,,{,...|||.,,...((((((.((,,..((((,,((((((,......({({.{.,{{,|{{{|,,..}|||,...|}|,.,.}|}}}}}}}}..}}}},..|.}}}}.|}}|(((,(((,{(({(((((((((((({,((.(((((,,(((((((..,,.,,(((((..,|}}}}{{(({{...{{((,,|..(((((((,,{{..{(({((.{{{{({,..|.|((((({.((,,...,.||.||,|||.....,))}},.)))))}......)),,))})}}}||||||{||.{|{||||{{{{(.{{((,.{{{{{({((....{(...{{||}{,.,.||,|,{{(((((.((((....((((((.(((.,(((.(((((....)))))....,,.((((((.....)))))).||.((((.(((....))).)))).,..((((...((((..(((((((((..(((((..((((...{((.((.((.{(((.((((((((((.,..((((((((..((((((..((((((((..(((((((((((((((({.,((,({((((,,,.(({..,..(((((,,....{|||||....{{..,,|..{(({{{,,,||,|},|||},}||}}||}})|}.|..|||({{,,,((((.,{{.{{..,|}|}|||}}|||}}}.,.,{{{..,,....||}|.{||||||{|,.}}}|}|||((.{,||(((({....(((.(((((((((((((((...{.(((.((.((((((((...({,.,((((((((..((((..(((...((..((({,((.((.((((..((..(((((.....)))))..))..(((.((.(((.(({(((((((..((....))..)))))))..(((.,..((((((((((((.((((((.((.(((..,.((..((((((...))))))..))..))).)).)))}}))...)))),...(((........)))..,,,((((((((({{(({.,,((((..(((((((....(((((.((.(((((((({((((.((((.(((((({(....}})))))))....,{...}|{(((((((((((....(((..((,.,(({(({{{,{..,{,.,...}))).,)}}}})).,...)))...)))).))))))),...(.((((((...)))))).)((((((....)))))))))).))}}....,,)))))))).)).)))))..))))))).))))..)))))))))))))..(((..(((((((((((,((.((((.....}))).)).,,,.))))))))).))..)))...(((((..{......}.))))).}}}}))))))))..,)))(((((...)))))..))).))).))))))))).)}..))))))..))...))).))))..))))))))))))))))..))).)).)))).)))))..((((.((....}),)))).))))({((((((((...((((...(((((((.....))))))).))))....,.((((((((({(,(((((..{((((....)).))}))))).........}))))).....))))),....)))))))).}}((((.(((((((((.,(((.((((((((({..(((((((((((,,,(((((,,,||.|||.,,,|}}}}}}}))))....||}.,{{||||||,|{{{{{{(((((((((....)))))))),..{((,{{.{|||.{{,,.|||||,|||}}}}}}((((.((((((((((((((..(((((((((((((((((.(((((.(.((,,{(,(({(((((((((((..{{,...{({((((((((.(((((((((((((.((((((.,,(((...,{|{{{..{{{{..,({{.,...})},,}}}}.,)}},}))}))))).).))))))))))))),.({(((((.,,,(({{{.,({{{.......{,....}|{,{((,,,,...,}}}}}........,}}}},....{{{{{{{({.............,}.,..,{{|||||}||||..{(((..((.(((....((((.((((((...))))))))))....}))}}..)))}..,}||,{..,..)}}}.(((((.....(((((((((....))))))}}))......))))).,..,,...))))).)))}.(((((((.(((((..(((....(.((,...,)),,...))))))))....)))))))...|||..,,...........)},.((((.(({..(((.(((({{((((((.((((((({..((((.(((((..(((((.(((.,...,,....,....,,.)))..)))))))))).))))}}}..)))))...)))))))))))..))).,.)}))))......,((((((((.(({..((((..,...((((((((((((((((((((((,,(((({{{,|}}||,....|||{|.(((({....((((....))))}}||,{|}|||||||||||}..}}|||||{||}}|||..}}}.)))))}},,,|........((((.....))))(((((((((((((((..(((((((({(((((.(((((...,.......(((.((((((((.,.((((............(((((......)))))(((((....((((((.,.....((((.(((..,.(((((.(((((...))))).))))).(((.((((((,..((((....)))).,.))))))))).))).))))}.)))))))))))..)))),)))).)))))))....))))).))))).{((((((((((((...(((((((((((((..({..{{({{,{{{{..,||{}},}}}...........,,,........}}}..,|||{{{{.{{|,||((((.((((((,((...(((((..((({...})))..))))),,,)}.(((......)))......((({...}))))))))).)))}.{,|...)))}}}..(((((((((.(({........,((((...,((((.(((....))).)))).)....)))))))...)))))))))...{{{|,,.)})),})}))).))))))))))).)))))))).,.(((((({.....)))))))..}))))))|,{{,.,{{{.,..,,),)}),,)))))))))..)))))}})))).))))).))))}.)))))))).)))))))))).,..))))..))).))).)))))}.},.))))}.,))))))))))))))).,,))))))))))(((((...)))))....,}))))..},....},,.))))).))))))))))).))))))))))(((((((.......))))))),(((,(((.{{{{({{(({.{((({((({{({{,..{{{|{{|{({,|{((.((((.(((.....({{....{(((((((.,((.{{.((((.......,|))},|.{|}..((((.((.((((((((.(((..((.....))..))}......))))))))...)).)))))))))))}....))).}}).))))))))})))}},....,,)})))))}.}))})){((((((,{{(,(({(({{((({((((((....,|{{(,,,,||}||||}..,,||}}||,}}|},|||}}}||||||}}}}}..||}{|{((,((.(((((((.......{{(((((.(..((({,{{{((...,,,,,..,|})}.}|}|,.}.}))}||}}..(((,..,|}}}((((((((((((((((.,(((((...)))))...,.))))..))))),...})))))).)}))))).)))))))})),{{((((((,..{,(({{.,({|....}}),.))}),)}))))))))})}},.|,||||.||||{{||},|,,{,,|}||{{,||{{{||||||.(((((..(({..(((((.,..,.........)))))..})})))))....,{(((.((((.,.,,.....((((((((((,{((..,{{|}},.((((....)))).((((((,,.....).))))))...((((.....)))).((((({....}))))).......((......)).,,(.((((((((.((((.........)))))))))))).)((((((..((((((((..(((((,{(((,..((((((.(((,....,,...))).)))))),,))}))))))..((.((((((.,.((((((,.,{{.....(((((.(((((.((((.{,,{..(((((...({.......,,,.))))),})}.)))).))))).))))),..(((((.......))))).}}))))))).,.)))))).})}....{(({.(((.((((.((..({...})..)).))))))).)))}.(((((.((....)).)))))......)))).)))).))))))....},},,,))))))))))..,}},}},||.{(((....)))))))))).)))})}}}}},,}.}}}},}}}}}}||}}}..,,,,,..,,,,||))))})).)})).}))}.},}}},|,,}}}.||,.|||}.}))..,))))).,.)))))))))).....)))).|||||||}}.|,|||||.|||||....(((((((.....))))))).|||||}||.||}}}})),}},)|}|||||||,{||||,.,,)))))}|||||,..,)}},.....|.,{........||{|,.,),,)))))))))).))).,.))))))},))))))(((((((....)))))))...)))))).))){{{{|.{(((((...((.(((((........))))).)).))))))}}}(((((({{{...,.(((({..((.(((.......))).)}.......))))}))))))))),,.{||{|..|{|||,|.,..,,)}}}))),,))))).)))})}}))})),)))))).))))).)))).........(((......(((((((.((((.........)))).)))))))....)))....))..))))))}..,.}..)))))))..)).))))))..,..))))))))).)).)}.)).)).))}..)))))))))..))))))))).....))))...))))})).,))),))))))........{((((((((((((((((...((....))...)))))....(.(((..((((((((....(((((......)))))..))))))))....))).).})))))))...))))...)))).))))))))})),}.}})),})}),..))..,)),...)))},))})))).)}))))....)))))).,....{(((((...{,(((((((({({......)))))))))).),..)))))).........}})))))}})))),,)))))))))}})))..))))).)).)}}}))))))).})}||}||,,...}}),))}.))).)))).)),)))).))))))).))))).))))))....))))))).))))))).(((((...)))))((((((((((,{({....))}...((((((((((.(((..{,,{........})}..)))))))))))))...,{{.,,.....,.,))))))))))))))..(((((((..(((((((((((....}))))),.}))))....))))))).(((((..{((((((.((((,{{{{.......,,,}}..,.|{|.(((((((((({,..{{{({|,,...,,,}}}},,...{((.(((((((...((((((.((.....))))))))..)))}.,))),))).}})))))))}}}{|,.(((..(((((((....)))))))..)))..}}.)))).)))),))}.))))).{((((((((((...)))))).)).))})))))))))).{{,{{{{,,((((({,{((({.,..{,,....,}},,}.))))),}....,,...,,)}}}}}}((((((...))))))...........{{{{{{{{(((({{(||,...}}.))}}||..(((((((.(((........{(((((.....})))))))))))))))........{{{{,.{{,..(((({{{.,{{||{|,..,,|{,{{{((((...{{((((((((.....))).))))).)).....)))))))}|,.,,,,..}}}}},.{{{{.((({.,.}})).)))).)))))))...,}},))))))}))).}.)))))))))....{(({(,,(((,,....}}}.))))}..,}}}|,.((((...((((..(((((((((.(((((((((......)))))..))))...)))))))))..))))...))))....,},,,..

Transcripts

ID Sequence Length GC content
CAGUCCCGCCGCCGCGGCAGCCAACAUGGCUGCGCUCCGGAGCCCGGGA… 7644 nt 0.5740
Summary

This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.