| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAGUCAGCCGGCCGGAGACAGAGACUUCACGACUCCCAGUCUCCUCC… | 1418 nt | 0.5381 |
This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. The encoded protein may play a role in bone development and fracture healing. Mutation in this gene, which is located in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7, may be associated with split-hand/split-foot malformation. [provided by RefSeq, Jul 2008]
A review of proteomic applications in forensic science spanning 2004–2024, which included studies on human and animal models such as pig, rat, and mouse, identified the DLX5 as a protein marker showing loss post-mortem in bone for late post-mortem interval estimation [Alex et al. DOI:10.1016/j.scijus.2025.101320].