Basic Information

Symbol
DNAH11
RNA class
mRNA
Alias
Dynein Axonemal Heavy Chain 11 Dnahc11 DNAHBL DPL11 CILD7 DNHBL Dynein, Axonemal, Heavy Polypeptide 11 Axonemal Beta Dynein Heavy Chain 11 Dynein, Ciliary, Heavy Chain 11 Ciliary Dynein Heavy Chain 11 Dynein Heavy Chain 11, Axonemal Axonemal Dynein Heavy Chain 11 Dynein, Heavy Chain Beta-Like
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_001277115.2
Sequence length
14343.0 nt
GC content
0.4489

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-4290.80 kcal/mol
Thermodynamic ensemble
Free energy: -4567.05 kcal/mol
Frequency: 2.19286e-195
Diversity: 3621.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((.(((((.((((((...(((((((((((((......)))))))).....))))).)))))).)))).).)))))))).(((((((((..((.((((((((.(.((((((((....)))))))).).))).))))).)).(((((..(((((.((..........((((((((((((((.((.(((...((((((...(((....)))...))))))))))).)))))))).((((...))))((((((..............)))))))))))))).)))))..)))))))))).))))..((((((((.((((.(...((((((((((((((.(((((((.((((((....(((((.(.....).))))))))))))))).))).)))))))(((......))).((((((.(((.........((((((.(((((((...((((.(((((...((((.((((((((((((((((((((((((.((((((..(((((((((((.((((((((((((((...((....))..)))))...((((((((.((((((((((...(((((..(((((.........((((((((((((((((((((((((......)))).)))))....))))))))).)))))))))))...)).)))))))))))))...((((.(.(((((.((((((.(((((..(((...((((((......))))))...))))))))(((((((......(((((....(((((...))))).....)))))........((((((.((...((((((((.(.....).)))))))).)))))))).(((.((((..(....)..))))...)))....)))))))..((((((...)))))).....))))))..))))).)..))))....((((.((((((((.(..((((....(((...........))).......))))..).))))))))))))((((((((.((((.(((((((.((.((((((((..(((((......))))).....)))))))).))..(((((((.(((.....(((((.(((((.(.......((((((((....((..((....(((.(...........))))...))..)).....)).))))))((((((((..((((.....(((((..(((...(((((((((((((..(((.....)))..((((..((((((((.....)))))))).))))..((.....))((((((.(((((.((((((((((((.....(((.((.....)).)))..))))))((((...(((((((((.(((.((((((((((((((((.....(((((.(((((((((((..((((((((........(((((((.((((..(((((.(((((((((((..........)))))).))).)).)....)))).)))))))))))..((((((...((((((((((((((((((((((.......)))))...((((..((((.((((....))))..))))...(((((.(((((.(((((((..((((((.((((.(((((((.(.((((......(((.((((.......)))).)))............))))).))))))))))))))))).)))))))))))).))))).)))))))))...))))...))))..))))...))))))))))))))..)))))))))))))))).((((......))))...))))))))).((.((((.((......)).)))).))..((((...((((((..(((((((((......))).)))))).(((((((((...((((....)))).))))))))).........((((.(((((((((.......)))))))))))))...(((((((((((..((.((.....)).))..)))))))))))))).))))))).((((....))))...(((.....))))))))))..))))))))..))))....)))).............)))))))))))))).))).((((((...)))))).((((.((..((((..((....((...(((.((((((((((((((((..........((((((((.((.....((((.(((((((((((.(((.((((((((((...(((.((((((((.(.....).)))))...(((((.((((((....(.((((((((.(((((((...((((((((................))))))))....)).....))))).))).))))))...))))))..))))).((((....)))).......))))))...))).))))))).))))))).)....)))))).))))((((((....))))))...))..)))))))).......((((((((((((((((((((....((...............(((((..((((.........))))))))).(((((((....((((....(((......)))..))))..)))))))))..))))))))).)))))..(((.......)))))))))...(((((((...)))))))...))).)))))..)))))))).)))))))..))))..)).)))).)))))))....)))).))...)))..)))))))))))))))))).))))).)))))..((((...(((((((((((.((.....))(((((..(((....)))..)))))(((((((((((((((.((.(((((((.........((((((((............)))))))).))))))).)).))))))..((.(((.....)))))((((........((((((((((..(((((((.((((((((((.(((((((....(((.(((..((((((..(...(((((((((((((((((((((.(((((((..((((.(((((((((...((((((.......)))))).((((((......((((.((.....(((........)))...)).))))......)))))))))))).((.(((((((.(......)))))))).))(((((((......)))))))....))).))))))))))).)))(((((((((....((((((((....(((.(((((((((..................(((((((.....))))))).(((((((....)))))))............(((((((.((((((((((((....(((((...)))))((((.......(((....)))........))))(((((.((.(((.(((..........))).(((((..((((((((.(((.((((.((.......)).))))))).))))))))..)))))......))).)).)))))...((((((.....)).))))...)).))))))))))...))))))).(.(((((((......))))))).).))))).)))))))....)))))))).))))))))))))))))))).(((....)))....))))))))...).)))))).))).))))))))))(((.((..((.(((((.(((...)))))))).)).))))).......(((((((.((.(((...(((((.(.....(((((............((((((.(..((((..((((..((((..((.(((((((((((((((....(((.....(((((....((((....(((((.........)))))....))))..))))).....))))))))))))))))))))...(((((.....(((.....))).....)))))...))))...))))))))..).)))))).......((.((((.....)))).))))))).....).)))))))).)).)))))))............((((((((.(.....))))))))))))))))))).))))..........((......(((((((........)))))))......)).........)))...))))))))))....))))...........(.((((....)))).)..)).)))))))..((((((((((..((((((............((((((((.(((((((.....................((((.((...(((((((((.(((((......))))).))))))..))).....))))))((.(.((((((((((.((.((((((((((((((.........((....))..((((...(((((........(((((((.(((((((((((((((.......(((((((((((((((((((((((.((((.((((((((((((((......((.(((....))).)))))))))))))..))).......((((((......)))...))).)))).)))))))))......((((((((((..((((((((((.((((((........(((((..((((........)))).....)))))((((((((((((.(((((((((((((((...(((((...((((....))))..)))))((....)).((((.(((......))).))))........(((((..............)))))....((((((((((((...(((((.(....(((((((((.((((..(((.(((.(((((.(.((((((.....))))))).))))).))).)))..((((.................)))).(((((..((((((......))))))))))))))))))))))))....))))))......(((((((((((..(((....)))..(((((.(((((.(((..(......)..))).))))).)))))(((((.(((...(((..(((((.((((........(((((((.(((...(((((((..((((.(((.....))).)))).................((((...((((((.((.....)).))))))...)))).......(((((....((.....)).)))))..)))))))...)))...)))))))......)))))))))..))).....))).))))).......(((((.........)))))....(((((((....((((((....)))))))))))))...(((((.((((((..(((((..(((..((((((((..............(((.....))))))))))))))..))))).((.((((((((((((....)))))))...((((((((((..(((..(((((........)))))...)))....(((((((((((((..(((...(((.....))))))..))))))).))))))..........))))))))))....(((.(..........).))).))))).)).......((((((((............)))))))).))))))..))))).((....)).........((.(((((((((......................))))))))).))(((....))))))))))))))......((((.(((((...)))))))))..(((((.........)))))...........)))))))))))))))))))).)))))))...(((.(((((...(.(((....))).)...))))).)))....))))))))))))......((((((((((..((((((((.(((...)))))))..)))).(((((((.((..(((....)))..))........(((((......))))).........((((.(((......)))))))((((((((((((..(((.((((.((.(.(((.(((.((((((.((..(.((.(((......))).))).)).)))))).))).)))..).)))))).((..(((((.......)))))..))...((((.....)))))))..))).))))))))))))))))((((.((((((((....))).))).)).))))((((((...((((((((......(((((.....)))))..))))))))...))))))..(((((((....))))))).)))....)))))))..((((((.(((((((..((..........((((((.((((((((((..(.((..(((......)))..........(((((...((((.....(.((((...)))).)))))....))))).((((((((((((((...........)))))))))))))).)))..))).)))))))...))))))..(((.....))).(((((..((((.....))))..)))))...))..))))))))).)))))))))).))))))))))..))))))))))((((((.....(((((.((((((((((((((((........))..(((....)))......(((..(.....)..)))..((((((.((((((.(...(((((.....)))))..).)))))).).)))))((((....)))).((((.....(((((..(((.((((((((((((.((((((((((.((......(((....)))...)).))))))((((((.((((((......((((((((((((.(((.(((.((..((((((.(((.((.(.((....)).).))..)))..))))))..)).))).....((((((....((((((((......((((.......)))).....)))))))).....)))))).))).)))))).)))))).))))))))))))(((((....(((((.((((((((.(((((((..(((((....(..((((..(((((.(((((..((...(((((...........)))))...)).....((((((((((.(((((((((.((((((((..((.(((((((.((.(.(((((((((.((.(...((.(((((((((..((((....((((..(.((((..........((((((....)))))).((((.........))))((((((...(((......)))....)))))).......)))))..))))))))..)).))))))).))...).)).))))).....)))).).))))).(.((((.(((..(((......)))..))).)))))...........)))).)).)))))))).)))))........)))).).)))))))))))))).)))))..))))..)....)))))..))).)))).)).).))))).))))).))))))))).)))))....)))))))..)))..)))))......))))(((((...........)))))........))))))))).))))).)))))..(((((((((((..(((...(((((((..((((((....)))))).....((((((....)))))).))))))).....(((((((.........))).)))).(((((..((((..((..(((((.((((...)))).)).)))..))..))))))))).)))..)))))..))))))........))))))...)))))))(((.((((((((((((((.....))).))))..))).))))))).......(((((((...(((((.....(((....))).....(((.((.(((((((..(((((((((.......((..(((((((((((.(((((((.((.....((.(((((.(..((((((((.(.((.((.(((.....(((.(((..(((((((...(((......(((((.((......)).)))))....((((((((........(((.(.((.((((((((.......)))))))).)).).))).(((((.((((..(((....)))....))))..)))))...........))).))))).)))..)))....))))..))))))))).)).)).).)).))))))....).))))).))))))))))).))))))))))).))....((((((((......))))))))..)))).(((((.(((...........((((((((((((((..........)))))))))...)))))..))).))))).........)))))))))))).))))))))))...)))))))......((((.((((....)))))))))))))))......))))))))).........))))))..)))))))......))))).....)))).)))))))...((((.(((.(((((...(((((.((..(((((((...........))))))))))))))...)))))..))))))).....)))))))..)).))))))))))))).(((((((.(........).))))))).......)))))))))))))))..........))))))..(((((.((((...)))).))))).............)))))))))))))))))))))...)))).....))))))))))(((.....)))....(((.(.(((((.....))))).).))).))))))).))))..)))..)))))((((((........((((((..(((......)))..))))))))))))..(((((((((...)))).)))))(((.(((((((.((....)).))......))))))))))))))))..))))))))).)))).)))))))............))))))..))))...(((((((((((..((((..............)))).))))))))))).)))))))))))).((((.....))))..........(((.....))).)))))))).)))).....))))).))))..)))))))...))))))((((.((((((((((((.((........((((.(((((.....((((((((.(((.((((..(((....))))))).)))(((((((.((((.((((.((((...)))).)))).(((((((.(((((.(((.(((((.(.....).)))))...)))))))).)))))))((.......))...)))).)))))))))))))))))))).)))).((((((((((....(((((....)))))(((((.((((((........)))))).).))))))))).))))))))).)))))))))).)))).((((.((((((((.((((((((.......(((((..(((((((((.....(((((....(((((((((((((.((.(..(((((((((((((.........((.(((........))))).......(((((((.....................))))))).(((((........)))))......((((.(((...((((((......((.((((((...........((.((((....(((........)))....))))..)).(((((...(.((((((((((((((((((((((((((((((.(((.((((((((.((((....))).).)))...))))).((((.....))))(((((((((..((((((((.(((((((((...(((((((((.((((..((((.(.(((((((..(((((((.(((..(((.(((...(((..(((.......)))....)))...))))))((((...))))...))))))))))...(((((.((((......((((....)))).......)))))))))...))))))).)...)))).))))(((((.((....)).)))))....))))))))).))))))))))).(((........))).(((((...(((((.....)))))...)))))..(((...(((..(.((((((((((....(((((((.(((.((((..(((((....(((((((..(((((((..((((((((......))))))))...))))...((((((..((((((.(((.(((((((..(((((((..((((((((((.....((..((((((((((.((.((((........)))).))...((((((((((((((......))..(((..(((((....(.......)....)))))..)))...........(((((((.(((((...(((((.((((.((((..(((.....))).)))).)))))))))..)))))...))).....(((((....((((((....((..((((.........................(((.(((((......(((.(((((...((((((...((((.((((((((((((.........(((((((((........((((((((((((....))).)).)))))))..(((((((.(((((((...((((((..(((((.....(((((..((((((...)))))).))))).((((((.......(((((....))))).......))))))....)))))))((((.......))))....))))...)))...)))).)))))))........))))))))).......((((...))))(((((.....(((((..(((.........).))..)).)))...)))))...)).)))))))..((((..(((..(((.............)))..)))...))))...(((((.((...((((((((...((((((...........))))))..)))))))).))))))).(((.......))).....(((......)))((..(((((((((((....(((.(((...................)))...)))...)))))))))))..)).....(((.......))).))))))).))))))))))).))).....))))).))))))).))....))))))........)))))....)))).......)))))).))))))..))))))))))..))))))))))))..)))))))....)).)))))....))).)))))).))))))...(((((.((.....)).)))))..(((.((((....)))).)))))).)))))))..(((((.((((.(((...(((((((.((.(..((..((((((....(..(((((...)))).)..)....))))))........))..))).)))))))....))).)))).)))))..(((..........................))).......((((((......))))))((....))..)))))..))))...)))))))))).....)))))))))).)..)))...))).))))))))))))))).....(((.((((...)))).))).....((.(((((....((.((((((((.((((((..((.(((((((....)))))))))....))).))))))))))).))....)))))..))))).)))))).))).)))).))......(((...))).)))))))).))))))).))))))....(((((.......)))))...))))))..))))))))..)))))))((((...(((((..(((((....((((......))))..))))).....)))))...))))(((....)))((((.((((..(((((..(((((...........(((..(((...((((.((((((((((((((((((((...((..(((.((((....((........((........)).........(((((.......)))))(((((((((((.....((((((((.((((.(.....((.(((((((((.....((((((((((...(((((.(((((.....((((.((((.((((((((((...((....(((.((((.........((((((((.............((.(((.((((..((((((....))))))..))))..)))))((((((((.....((((((((...(((.(((...((((....))))......((((((..(((...))).))))))(((.((....)).))).(((((.....)))))..((((((..........)))))).......))).)))..)))))))).))))))))((((((((.((.(((((((.(((((((((((.(((((((.............))))))).))...)))))))))............(((((.....)))))..)))))))))..((((....))))......(((....))).......((((((..((..((......))..))..))))))..........(((((.....)))))......))))))))((((((((...(((((....)))))..))).))))).((((((.((.......)))))))).(((.((......)).))))))))).)))))))))...)))))))).))))...)))).)))))))))))))).))))))))))....((((((.....)))))).((((((((.(..(((((((............).)))))).).))))).)))..((((...)))).))))))..))).))).)))))))))))))))))))))))........((((((.....).)))))..))....)))))))..)).....))))))....((.(((..((..(((.((......)).))).))..)))))..))))))))).....((...))))))).)))).)))..))).))))))))))....))))))))((((.(((((....((((((((((.......))))))).).))....)).))))))))))))))).)))))..).)).))........)))))))))))....)))))((((....((((((((....))))))))..))))..(((((((((((((((((.......(((((((..(((.(((..(((((..((.(((((((..((..(((((((........))))))))).))))....)))....))..)))))..)))..))).)))))))..........))))))))).))))))))...((((((..(((((.((((.((....)).))))..)))))..)))).))..))))))))))))))(((((...(((...))).)))))))))))))...))))))))))))))).))))))....((((....))))...........((((..(((....)))...)))))))))))..)))))..))))))))..(((((....)))))....(.((((........)))).).....)))).......(((((((((................((((((((..((((((.(((((((.....)))..(((((...((((((.(((...))).)))))))))))((((((.((.....(((((......)))))..(((((.......)).)))((((((...))))))(((..(((.((((...(.(((...(((((......................))))).))).)...)))).))))))..((((.((((((((((......))))..(((((...)))))((((.((((((((.((((...((((((((((.((((((((...(((.....(((..((..(((((((((((...(((((..((((((...)))).))...)))))....))))..)))))))..))..)))....)))..)))))))).))....)).))))))....)))).))))))))...)))).....(((((((..((((..................((..(((((((((..((.(((.(((....(((((......)))))......(((((.((((......(((..(((((((((....((.(((((((.((.......))..))))))).)))))))))))...))).......)))))))))............((((.........)))).(((....)))...(((....))).(((.((..((((((...(((.(..((((((.................))))))..)...)))....))))))...........)).))).)))))).)).))))))).))..)).))))..)))))))...)))))))))))))))))).......)))).))))))..)))))))))))))))))..............((((((...))))))..
Thermodynamic Ensemble Prediction
(,((({.(((((((..(((((((.(((((,{,{{(((((((......)))))||||,,..,,})),))|{||{|((((((.(((((,.((((...}))).((.((((((((.(.((((((((....)))))))).).))).))))).)))))))..))))))((((..((.(((....)))(((((((({((.{{,..{((((((...(((....))).,.))))))))))),)))))))).((((...)))).}},.}})).})))))..})))).)))))))..)))))))..}))))((((((((((..(((.((((((.(((...(((.,...(((((((.((((((({((((((....{((((,,.....).))))))))))))))).))).)))))))(((,....,))},((((((.(((.,,.....{((((((.(((((((...(((({(((((...((((.((((((((((((((((((((((((.((((((.{(((((((((((.((((((((({.{.(((.((((.(((....))).))))))).}...((((((((.(((...,,......,,..,,,.,,((((({((((((((((((((((((......)))).)))}}.,,.))))))))).})))))|((({{{.,|(({{((((..{|||.{{({,..{{,{(({{(({(((({{(((((,((({{,{((((,,,...,|||||{{(((.......))))..}}}}}},{{{{....||(({|,.,|||}.,,},}}}}|,,,.,...{{{{{..((((((((((((((((({....(((((((((((.|{{{{..(({(.......}}})..)))}{.(((((((((.(((((..((((((...)))))).{{.{(,(,...,},..}}....{((((((.(.(((((((..,((((((.((({{((.,,.|||},.{((((({...,{{{.({{,(,({...((((((((((((((((..((((,..,..((.((((((((..(((((......))))).....)))))))).)}....,((((({....}))))},,.,,((((((((({(((({{,((.....(((..((({((((((..{{...((((((((((....((({.(((((..(,((((((....(((((.(({,(((((((({...,,..(((,{((((((({,(((,.{{({((((((((((((((((((.....)))))))).(({{......,))).........,,.......,,||((((((.(((((((..((((((((...((((.((...((((.(((((((((.{{,.((((((((((((((({....((((,{(((((((((((..((((((((........(((((({,((((..(((((.(((((((((({..........}))))).))).)).,...})))).)))))))))))..((((((...(((((((((((,((((((((((.......)))},....,,,..{(((.((((....))))..))))|..(((((.((({{((((((((..((((((.{(((.(((((((.,{((({..,,|,(((.((((.......)))).)))..,..,,.,...,,,,),)))))))}))})))))).)))))))))))).))))).,}}))))))...)))}...)))}.}))))...))))))))))))))..)))))))))))))))).{{{,......}))).,,,))))))))..{{,((((((.(((((((((((((((..(((..{.((((((......,(((((..(((((........)))}})..))))}((((....))))((((((((((...((((((((((.(((((((((.......)))))))))))},.{((((({...})))))).....,.(((((((..(({.,,((((((((,,((,{{,((((....))))..,)))...,,..)).)))))}(((((((...(((((.(...{(({.(((((..,,....,,..))))).))))}}.((((({...}))))).((((.(({{((((..({....((...(((.(((((((({(((((({......,{,.,((((({{{((,,..{((((.((((((,((((.(((.((((((((((...(((.((((({({.{.....}.})))}...,((({.((((((....(.((((((((.((((({{,,,((((((({.,...|.......},.))))))))....}}..,,.))))).)))}})))),,..))))))..))))}.((({....)))).......))))))...))).))))))).})))))}.}....)))))).))))|{{(((....)))}}|...,...},,}}}}}....,.,,,((((((((((((((((((,,{.((.....}}.,}},...(((((..((({.........}))}))))).(((((((....((((....(((......)))..))))..))))))).,..))))))))).))))))}|||.,}},,,)))},|})}..,(((((((...)))))))...))).})))}..)))))))).)))}}))..)))),}))})))),{,.,.{{{....})),}}..,.)))))...))))))).....(((((((..,..(((((....(((.(((((({(,((((((((..(((((..(((....)))..)))))....{{...((((((.((.(((((((.{((....{(,.((({,.....,,...,,})..)))..))))))).)).))))))....}}....)))))))){||{,.........,{|}}}}..,}),..}))))),,)))....)))))...))))))).,,.)))..))))))),}))))))))))))))))......))))))}..)))...)))))))))((((((.......)))))).....,,{,{,.,({{,.}|,,,|,|}|,(((((,...,,,|||.,}}....,))))))))))}....((.(((((((.(......}))))))).))(((((((,....,)))))))..)))))))))))),,.....({.{(((((((((((.{..................((((.((({...}))).))))..(((((((.....))))))).(((((((....)))))))..((((((..((.,....((((((...)))))).....,)}.,.))))))..........{((....))}........)))))))))))}.)))))))).)}))))))))).(((((..((((((((.(((.(,,(,((....,,,)}.},),))).))))))))..))))).......{,,{{.((((...(((((((((((((,,,........,|||{{{({{{....{(((((.(((((....))))}....|{{(((((((,..{(((((((((((((,(,{,.({(,{{{,..{({{,,,,,....,}}})))}},.}}},{{{{{......{(((((((((((((((..,(((.((.,((.((({(((((...)))))))),)).))))).,..............))))))...))))).))))).....}}}},...,,,,((((((,(,,((({..{{{{..||||,}||.((((((((((((((({....,({,...((({(....((((....(((((.........)))))....))))..)))))))...,}))))))))))))))))))...(((((.....(((.....}}},....)))))...)))),..}})}})))..,.)))))),.)))))))))))))))))))))},.,,,{{{.......|||{(((,(({((...,,,,.....((.((((((((((.{.....})))))))))).))}}|}},||||,.{{{{{{..((......(((((((........)))))))......)){(((....}}}}....(({{{{{{....||,|||{{{{{{{{..,.((((....)))),},))).})}.))))},}}},}}))))}))),,..||.,,.,,...,,....)))))))},,,,..,,,.)))))))))))))...))))..}})}{(((((.(((((......))))).)))))))))).....))))))...))))))))...)))))))..)))))).)}.,..,)))),,))))}((((((....))))))..,,,,...,})))))))))))))))).,,{{{,.,,.,((((...}))).,.||||||,,{,|{{,.((((((((((((((......((.(({....))).))))))))))))}..})},{{{{(.,,{|||,,,,..})}}.,{,|{|||,.||||||,........((((((((((..((((((((((.((((((...{(({,,(((((((((..,,,,.,{||({,,,..,{{,|((({,(((.(((.(((((((((((((((,..(((((...((((....))))..)))))((....)).{(((.(((......))).)))}...,{{..(((((.,,.........,.))))).}},{(((((((((((...(((((.(....(((((((((.((((..(((,(((.(((((.(.((((((.....))))))}.}))}},|||,}|}..((((.................)))).{||||,.|{((({......))))))))))))))))))))))))....}))))).....{((((((((((({,(,,....|||..{((((,({{((.{{{,,(,,,.,,|,,|||,}||||,||||}(((((.(((...(((..(((({{((((..,,....(((((((.(((.,.(((((((..{(({.{{{....,|||.|}}}.......,,.}},,,..((((..,((((((.((.....)).)))))}.,.)))).,...,,((({,....((.....)).)))))..)))))))...)))...)))))))......)))))))))..))).....))}.)))))......|{{{,......,}}}))},),,,.|||||,,.||,||((((....}))))}}}}}|}}...(((((.((((((..(((((..(((..((((((((.{{,.,........,..,,.,}).,)))))))))))..))))).((.((((((((((((....)))))))...((((((((((.,{((..(((((........)))))...})}....(((((((((((((..((({..,({.....))))))..))))))).))))))........,.))))))))))....(((.{.........,)}))).))))).)).......((((((((............)))))))).))))))..))))).{|...,)}.........|{.(((((((((.{,,...............,,.))))))))).}}||{..,,))})))))))))))}.....(({,.(((((.,,|}}}}}|||,.,{{{{,.,,,,},}))))),..........)))))))))))))))))))),,)))))).))).))}}||}},,}}}||,,,.}},{{{{......})))....},)))))))))),,,...{((((({((({,((((((({.(((...}}}}}}},,))}|.(((((((.,..,(({,,..,,}..||....,|,.(((((......))))).........((({{(((......)))))))|(((((((((((..(((.((((.,{.{.(((.(((.((((((.({..{.((.{((......))}.))).)).)))))).))).)))..}.}})))).((..(((((.......)))))..))...,(((.....)))))))..))).))))))))}))))))),|{{.{|||||||,..{|||{|||{,,.,,,,((((((...((((((((......(((((.....)))))..))))))))...))))))..,||||||}}}.,,}}}}}|}}|,,,,|}))))|..(({{{{.||||{{{.,{{..........((((((.((((((((((..(,{{..(((......)))..........(((((..,((((.....(.((({...}))).,)))).,..))))).(((({{((((((((.,......}.,))))))))}})))).}))..))),,))))))...))))))..{{{,||,.,,,.,{{{{..((({.....))))..))))),..}},.))))))))).)))))))))).))))))))))..))))))))))..((((((.......)))))),,,,,,.}|||},|,..,}.)))..)},,)))))))))..(((,,,.....),.)))..,{{{((.((((((.{...(((((.....)))))..}.)))))).)),}})))))))))..)))))).),.))))).})))))))))..))))...}}...))))))..|}}}}}}.{{|||,{|,||{,,,{||||||||{(((.((((((.,....((((((((((({.(((.(((.((..((((((.(((.((.{.((....)).},)}..)))..))))))..)).))).....((((((....((((((((......((((.......)))).....))))))))..,..)))))).))).}))))).)))))),)))))))))}{(((((.....(((((((((...((((((((((,(((.(({,(((,,.......,..........,)))))}),,..)))))))).)),{,.........,)),.)))))))))}}}}},...|{,{{((((.{.{(((,{........})))}.})))))}..}},,......,,}},,,|}},))))}}|}})))}}}}.....}})).))))))))))..)))))).,,}},|}}}||}},((((((...(((......))}....)))))).({{{...(((((({{.((((((.,((((...(((...((((....))))})).}))).)))))}.,,|.,.)))))).}}}}......|||.{((,{{{(({,(,,((((.((,.......,.)}.}))),,))))}....}}}|}}}},|.}||}||}}}....}}.,..}},,}}}},,}))))}...})))))),,))}}}))}..))))).)))).))))}.,))))))))))),,..}}}}}..,})))))))))))))|||||{{.((((((..{.((((.((((((,....,))))))...)))).}...)))))).}}))}}}||,,{{(({{|..((((((....)))))}..,..((((((....)))))),)))))))}})}}},}}...})).}}}}}}})}}})}),)))))}||,{{,|,,,|{.,,.((((,.,}}}}.,..,}}...,,,,|||,,((((((..........)))))).......|||{||||{||{,{{{{{{|,((((((((((({{{.....})).))))..))).))))}}||....},{{{{{((,,,(((({|,|,.{({....}}),,..,(((.((.(((((((..(((((((((.......,{..(((((((((((.(((((({,((.....((.(((((.{..((((((((.{.((.((.(({.....{{{.{{{..{{{{{(({{.{,,......(((((.((......)).)))))...,||||({((....,,,,(((.(.((.((((((((.......)))))))}.)).).))).(((((.((((..(((....)))....))))..))))){{{,{,.....))).},))).,}}....}..,.))))..})))))))).)).)).,.)).))))))....,.))))).))))))))))).))))))))))).},....((((((((,....,))))))))..)))),(((((.(((,..........((((((((((((((..........)))))))))...)))))..))).))))).........}))))))))))).)))))))))).,.))))))}..,,|,},,}|||||}}..}}})}}}}}}}}||}},.,,|,||}}}}||,,|}}}}})),}}.|||}}},..,,,.,.{(({(,,,...,,.......{(((({..,,,|}||}|}...,,{,{(({(({,(((((((...........))))))),|||||,....(({((...|{{||....,.{{{{(({,(((((,{(((({.....(((((({,|,,.....,}.)))))))....)))}|{|{{..,{||||||,...,..},)))})},}.,,}}}},.....,,))})),)))})))}))},...((((......))))(((((..{({,,((......)),))},)))))..}}})),.,..{{{.(.(((((.....))))).}.}}},||||||||.{{||..,))}}.}}|||||{{,...,,..((((((..(((......)))..)))))))))})}}.((((({(((({...,}))))}.)))))|}}|||,,,....|,.{({....))),},))))))))))).,))))))))).)))).))))))).,......,},.))))))..))))...(((((((((((..((({..,,(({....})))))).))))))))))).)))))))))))).((((,...|))))..........(((|...}))).)))))))).)))).....)))))}))))..)))))))...))))))|(((.((((((((((((.((.......,((((.(((((.....((((((((.(((.((((..(((....))))))).)))(((((({.{{{{,{{({.{((,...})}||}}}.,(((((((.(((((.(((.(((((,(....,).)))))...)))))))).)))))))|{,,.....}}.,,}}}}.}))))))))))))))))))).))))}((((((((((,,..(((({,,,.|}}}}|{(({,{{{(((,,...,..)))),)})})))}))))).))))))))).)))))))))).)))}.((((.((((((((.((((((({....||.{((({..(((((((((.....,((((....(((((((((((.{,{(.(..(((((((((((((............{{{{..(({.((((((,...((((((.(((.........,,.,.....,,,{,,{(((.(((((........))))).)))}.,{{{{......,.}|||....,{|||,{{,,........,..,{{{((({....(((........}}}....}}},..}}}|||||}}}|{(((((((,{{{((((({(((((((((((({.(((.((((((((.((((....))).).)))...))))).((((.....))))(((((((((..(((((({(.(((((((((...(((((((((.((((..((((.(.(((((((..(((((({((((.,({.{(((...(((..,((.......)})....)))...))))},{((||||}|||,..,}||||||||...||||{,|{{{......{{{{..,,))}),,.,,,.)))))))))...))))))).}...)))).))))(((((.((....)).)))))....))))))))).))))))))))}.{((,....,..|||,{((((...(((((.....)))))...))))},,|||,...((({({((,((({{{{.,.,||||||||{{|,|||{..{((({....(((((((..(((((((..((((((((......))))))))...))))...((((((,.((((((.(((.(((((((..{({(((({(((((((((((.....((..((((((((((.{(.((((........)))).}}...((((((((((((({......||..{((..(((((..,{,.......,...,))))},.)}}.,||......|||,||||.{{{{{...{((({{((((.((((..{{{.....|}}.)))).})))))))}..}}}}}...}}}....|(({{{....((((((....,{..(((({,........,..............,,,.(((((......(((.(((((...(((((({{{(,,{.{((((((((({,...,.....(((((((((....{{..((((((((((((,...})),))}}))))))..(((((((.(((((((...((((((,,(((((.....(((((..((((((...)))))).))))).((((((.......(((((....))))).......))))))....))))),.((((.......)))).,,}))))...))},.,)))).))))))).,}.....))))))))),}}}}}}||{,...,|||(({{{....,{({{{,.{{{,....,.,||||,.{||{||}.|{||}}}.},}},|||}}},..||}|}..,,.}||||.,..........}})}}}.}}}})}||,..(((((.((...((((((((...(((((({{.....,,..))))))..)))))))).))))))).|||,{,...,|||.....|||,..,..}},{{..(((((((((({{{..{{{.(((...................,}),..)))..,)))))))))))..)}..,..{{{..,,,,.,,,....)))).))))))))))).))).....))))).,,,)))).,,....)))))).......,)))))......,},,.....)))))),))))))..))))))))))..)))))))))))},))))))}}....)).))))}....))).)))))).}}}}}}...(((((.((.....),.)))))..|{{.|{{,....)))),)),))).)))))))..{{{{{,((((,(((,{.{{{{{||.{|,|,|||,.|||||{|{,.,...,{{{...||||,|{{,|.|{||||||,.......}|,||}|,||}}}}}....))},)})),)}}}}..,,{....,,,,{{{..,,....,,...,,|||.,.....((((((......)))))),|..,.))..)))))}}))})},,)))}})}})).),},)))}}})))},},.,))}},)),.))))))))))))))).....(((.((((...)))).))).....((.(((((....((.((((((((.((((((..((.(((((((....)))))))))....))).))))))))))).))....)))))..))))).})))))},)).)))).)}......{{{.,.|}}.}||}||||{||}},,,.|}}}}}....(((((.......)))))...{(((({{{{{{{{|||..|||{{|{{({{...,{(((,.||||||,..{|||,||{{{,.{{.{|||,|{{.,||}}||{{.,...(((....))){{{.{|({{...,}})}.)))...}}}.)))),}}}}}}}|,,{{{(,..}},)|}}}.}}}})}))..}}))))}}.,.|{{{......,........,|},.....}})}{{{({{{.(((((.......)))))..))))|(((((((({,((((.,.{......,.).)))))))))))))}....,{((((((((...(({((((((((,....((((.((((.((((({((({,,,,({,...((.(((...}}}.}},{({{{({{{|,.{{|...,{|{{,,,,.((((..((((((....))))))..)))).}))))}.,{{|}}...,,},||{||||,..|,,,,{,,,,((((....))))|||{{{(((({..,||{{{{|||{||.|.{((({(({((,,(((({.{((((,,...}}}}}..((((((......,...))))))...(((((((((((((((((....))))|,,...{..((((...})))..|..(((((((((((.(((((((.{..........}))))))).))...)))))))))........}))))))))))))..{{{{{{(,,,({..,,,((({....}))|....,.{{,.,.,}),....,,.,,||||}}|,.}||},.,,}))..))}}))))),...,}}})}.})})))}}},,)))}....{((((....))))|{|||||.,,.,)),))),,)))))}))}}))}}}}))|,}}}}.}.},.))))))|}.{|,.{{{{{{((((...)))))})})))..)))).,,},)))}})},))),..)))).}}})))))}))))).))))))))}}..,,((((((.....))))))})},,..}})}}}}}}))))))).)))))))))))).)))..}}}|((((((((.{{{,(((.,,.|||,|,}.,,..{(.({(((((((,.{((({({,...,)).}}}}}.((((((.....),}))))...{{.{(((((,....(({...,{{||......|.....}}.....))}},..}}}.)))))}},..((((({....})))))......})))))))),)).))))))))}..,.....,,......,.{((((((..{(((........)))}.(((((((.......))))))).,.....))))))).},..)))))))).)))))..},})..,........)))))))))))....))))|{{{{,,|.((((((({....}))))))),.)))),.(((((((((((((((((.......(((((((.,({(.(((..(((((..((.(((((((..((,.{((((((........))))))))).))))....)))....))..)))))..))).,})).)))))))..........)))))))))}})))))))...({{{((..(((((,{(((.((....,}.}}}}..))})}.,)))).)),.))))))))}))))){{(({...(((...))).)))))})))))))...))))))))))))))).))))))((((({{((((((.||,{{{{{{.,{((|((||{{{{|||{|{,{{{{|{{{||,,,{{,{|||{{{|||||{,..(((({....}))))..{.{|(({{,....,,,}))||}|,,|{||,,.....{{{{{{{..,|{{|.{{{{.,,.....,,,,..{{{,{,,{(((,((.(((.....)))..,||,|}}}{{|||(,(({..||}},}))))||,}||.((((((...))),,)).))..}}.}}}}}}}}},}|}|,,(((((((((((((((...)))))))))..)))))).....{((((....)))).,...........,...,||.,,..}|,||||,,|{}||.,,,..,,...((({{{((..((((......)))).})))))){((,...)))..,}||||}|}|},,...,})))},,}}}}))|},}|}},{||,,,}.}}))}}},,}}}.,|||{||||,||{{{{(((....)))))))||||}||||||,,.,|||||,.,,|}}}}|}}|},}},,|{||{{.........{{{....))).........)))))}|||}|||||.,{|({{.,..|}|{||},,}}{,||,........,,.||.....}}}}||||||||||||||.|,}.}}}|{(((......))))).....,(((((.((((..,,.,{{{..(((((((((....((.(((((((.((.......}}..))))))))).)))))))))...,,}.......)))))))))............((((.........)))).,,....,})}.,,(((....)),.})}}}|||},,.,..}||,{..{(((((((.,........,.)))))))).,.,|||||}},....||||||..........,}|,},,,))|.||||,,,}}))))..}},,||}}}}}||,},}))),,))}))),.))))))))))))..,..,.))}.,..))))))))).))).....(((((((.......)))))))))))))))))...

Transcripts

ID Sequence Length GC content
GUCCCAGGCCUUCGCUUCGGCCUGCGAGGCUACAGCUGUGCGCAGUGGC… 14343 nt 0.4489
Summary

This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]

Forensic Context

A study in mice demonstrated that mutations in the DNAH11 gene increase the risk of sepsis in patients with severe burn injuries, identifying it as a susceptibility gene for early warning of sepsis in this population [Huang et al. DOI:10.1093/burnst/tkac050].