Basic Information

Symbol
DNAJA2
RNA class
mRNA
Alias
DnaJ Heat Shock Protein Family (Hsp40) Member A2 HIRIP4 CPR3 DNAJ DNJ3 Cell Cycle Progression Restoration Gene 3 Protein DnaJ (Hsp40) Homolog, Subfamily A, Member 2 DnaJ Homolog Subfamily A Member 2 Renal Carcinoma Antigen NY-REN-14 Cell Cycle Progression 3 Protein HIRA Interacting Protein 4 HIRA-Interacting Protein 4 PRO3015 DJA2 RDJ2 Dnj3 DJ3 Dj3
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_005880.4
Sequence length
3008.0 nt
GC content
0.4013

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-837.90 kcal/mol
Thermodynamic ensemble
Free energy: -896.25 kcal/mol
Frequency: 0.0000
Diversity: 697.88
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((...((.(((((((((((((..(((((((.((...((((((((((.((((((......(((((((((((.........((((.(((.((.((((..((....(((((((.......))))..)))....))..)))).)).))).)))).((((........)))).....(((..((.....))..))).((((......))))((((......((.((((((((....................)))))))).))......)))).......)))))).))).)).....))))))..)))))..........)))))...)))))))))..)))))))))))))......((((((((((((((((((((((....((.(((..((((((..((((((((((((...(((.....)))..............((.(((..(((((.((((((.((((((((...(((...((((...(((........)))...)))).)))...))))...)))).)).)))).)))))))).))...(((((..(((((..(((((((...(((.....(((.(((..(((((.((((....)))).))))).))))))..)))....)))))))....)))))....))))).)))))))))))).))))))..))).)).................)))))...))))))))).))))))))...(((((.....))))).(((((((...(((((.((...((......))..)).))))).))))))).(((((.((((((............)))))))))))...)).))))))..(((((((((.((...)).)))))))))........(((((((((..((((((....(((((((.(............(((((..((..(((..((((((((....))))))))...)))(((((((((.(((.((.(((.((((..(((((((....))....)).)))..)))).))).))..))).))..)))))))((((((((..((......))..))))))))...((((.....)))).))..)))))).))))))))))))).........((((......)))).....)))))))))((((((((...)))....)))))...(((((((((..........)))...((((.((((((((((...(((((.(((((((((((...(((((((((.((((((...((((.....))))(((((.(((((((((((((((((((((.(((..((((.(((..(((((.(((((((.(((.(((((.....(((..(((((((((((...(((((.......)))))...)))..))))))))..))).....((.(((((.((......)).))))).)).))))))))))).))))((((((((((..............((((.((((......................))))))))....((((((........(((((.((((...)))))))))))))))...(((((((...........))))))).)))))))))).......))))).)))))))..))))))))..))))))))))....((((((.((((((((((((.....(((..(((((((((.....((((((((((((...((((((.....(((((.((((..((.....)).)))))))))...)))))).(((........)))....((((((((((.....)))))))).))......))))))))))))......)))))))))..)))...))))).)))))))...)))))).)))))).)))))(((((((((..((((((((((((.(((.(((.(((((((.(((((((((((..((((((....((((((((.(((...(((((((((((((((...(((.....)))....(((((((((((((....(((((.....)))))))))))))))))).......((.((((..(((....(((((..........(((.(((((((..........))))))).)))...........((((....))))....)))))..)))..))))))(((((((((((...(((((.....(((((.((((.(((((..((((((..........)))))))))).).)))).))))))))))...............(((((......)))))..((((((...............(((((((....)).))))).........(((.....(((...)))....))))))))).((((((((((.....))))))...)))))))))))))))))))))))..)))))))...))).))))))))....))))))((((((((..(((..((.((((((..(((((.............)))))..)))))).)).)))........)))))))))))))))))))(((((((.....)))))))(((((((((.((.....((((.......(((((((((.((((((((....(((((((......))).))))...)))))...........)))))))))))))))).....)))))))))))......))))))).))).))).)))))))))))).))))))))).............)))))))))))))))...(((((((..(.(((.......))).)..)))))))........((((..........))))))))).......)))))))))))..(((((.........))))).....)))))))))).))))....................((((((((((.((..(.((......)).)..)).))))).))))))))))).....(((((................))))))))........((((..(((((((.....)))))))....))))....
Thermodynamic Ensemble Prediction
((((({{{{.{{{.,(((((((((((((..(((((({,((...((((((((((.((((((......(((((((((((...,.,,...(((.(((.((.((((..((....(((((((.......)))}.,)))....))..)))).)).))).)))}.((((........)))).....(((..((.....))..))).((((......))))((((....,.((.((((({{{,,{..((({....}}})..})))))))).))...,..)))).......)))))).))).)).....))))))..)))))..........)))))...)))))))))..))))))))))))).,}}..,,,(((((((({{{{{{,||||}|||{{.((({,(((({(..{{{{{{{{,{{,,},|||},.,{|||{{{{{{...,{,{,{{,{{,,.{{|.}}|.||}..,{.{{{({,.,|||}|||{{,...((({..,,,..,},.((((({.,,,,{{{....,,|||}.}}})))},}}|{{{{.}|||,{((,,...}))))},|||||{,...,|||},||{{|{{((..{{{||.{{{{.,.,)))),))}}}.}}}}}||,,||{{{.,|||||{{{,{(((((...))))))}))))}}})))}}.,)))))..}}|,,|,{..,,..........,))})).,.,,|||||||||}}}||||,..(((((.....))))).,,||||(,,,((((({((,,,,....,,,||..}|,||}}|,||},|||.(((((.((((((............)))))))))))...||,|}}}}|,.(((((((((.({...)).))))))))),,.,|,.,{(({{,{{{.,|||||}..,|||{{|||},,..........,,.{{|,,,.,}},)))}|||||||,}}.}))))))),,...((((((((((.(((,((.{{{.{{((,,{{(((|,({{{{{..,.,,..))..,)))})),,)),,))).)}..)))))))}(((((((..{(......))..))))))),....,{||,},,}})},},,..,}}}}.)))))))}}))))}........((((......))))....,)}}}|}}},,||||,|.,}})))}}}}),,,}.,,(((((((((.........,))},..((((.((((((((((...(((({,(((((((((((...(((((((((.((((({...((((.....)))){((((.(((((((((((((((((((({,(((..({((,((({{,{{{,.(((({((.(((.(((((....,{((,,({{{{{{||||.,.(((((.......)))))...})}..|}}}})}}..))),,...({.(((((.((......)).))))).)).))))))))))),)))),||||||||,..............((((.((((...,,{,.,,|}}}...,,,,.}}}}}}},....((((({.......{(((((.((((...)))))))))))))))...(((((((...........))))))).}}}}|||||,........,},),)))))))..))))))))..))))))))))....((((((.((((((((((((.....({{..(((((({(({,...((((((((((((...((((((...,.(((({{((((..((.....)).))))))))).,.)))))).(((........)))....((((((((((.....)))))))).))......)))))))))))).....,)))))))))..}))...)))))},))))))...)))))).)))))).))))|(((((((((..((((((((((((.(((.(((.(((((({.,(((((((((({.((((((..{,{(((((((.(((.{.(((((((((((((((...,,{,..{{,{|,...(((((((((((((....(((({....,)))},))))))))))))),,,,,..,|.{(((.,(((....(((((..........(({.(((((((..........))))))).)))...........((((....))))....)))))..}))..))))}}(((((((((((.{.(((((.....(((((.((((.(((((..((((((..........)))))))))).).)))).)))))))))).,.............(((((......)))))..((((({..{{{.,.,......{((((({....))},)))).........,,{,|{{,{{{...}}}.,,.))))))))),(((({{{{{{.....}}})))...)))))))))))))))})))))),,}))))))).}.))).)))))))),...)))))){(((((((,......,..||{|||,,|||{{{{.{{{{,,...}}}},}}}}},}}},}}})),,...,...))))))))))))))))))}(((((((.....)))))))(((((((((.((.....((((,......{((((((((.{{{..((((....}}}}.......,{{(((({.......,,....)))))},)))))))))))))))).....)))))))))))......))))))).))).))).)))))))))))).))))))))),............)))))))))))))))...(((((((..{.(((.......))).}..))))))),,,,....{(((..........))))))))),......})))))))))).,(((((.........))))).....)))))))))).))))...........,,,......((((((((((.((..(.((......)).)..)).)))))}}))))}))))),,,,.,(((({,.........,..,,)))))))|........,{(((((((((((.....)))))))}))})}))}}}.

Transcripts

ID Sequence Length GC content
GCUGUCUCCCUCGGCCUGUGCCGCCGCCGACGCCGCUUGUGGGCCCGAC… 3008 nt 0.4013
Summary

The protein encoded by this gene belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain. The product of this gene works as a cochaperone of Hsp70s in protein folding and mitochondrial protein import in vitro. [provided by RefSeq, Jul 2008]

Forensic Context

A study in porcine skin demonstrated that the DNAJA2 gene was significantly increased in expression at 7 days post-exposure to cutaneous bromine injury, specifically in the 45-second and 8-minute exposure groups, and was identified as a component of the NRF2-mediated oxidative stress signaling pathway [Price et al. DOI:10.1016/j.toxlet.2008.08.007].