| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCAGUUCUUUGACCAUUCGUUGGAGCUCCGGUUUUCAGCCUCUUUCCG… | 1100 nt | 0.4009 |
This gene encodes a protein that in mice may function as a maternal factor during the preimplantation stage of development. In mice, this gene may play a role in transcriptional repression, cell division, and maintenance of cell pluripotentiality. In humans, related intronless loci are located on chromosomes 14 and X. [provided by RefSeq, Jul 2008]
A study in human and mouse samples demonstrated that the TRI reagent method effectively extracts high-yield, high-quality DNA and RNA from blood volumes as low as 2 µl, with DNA yields ranging from 618 ng to 1763 ng and RNA yields from 1542 ng to 5423 ng [Farivar et al. DOI:10.1016/J.Forsciint.2019.109931].