| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAUUAGGCCUGGUUUGCGCUGGAGAGUGGUCUUGGUUGUGAGGGUCAUA… | 659 nt | 0.4841 |
This gene encodes a protein that may function in the control of cell pluripotency and early embryogenesis. Expression of this gene is a specific marker for pluripotent stem cells. Pseudogenes of this gene are located on the short arm of chromosome 10 and the long arm of chromosomes 14 and 19. [provided by RefSeq, Dec 2010]
A study in human menstrual blood-derived mesenchymal cells (MBMCs) demonstrated that reprogramming to induced pluripotent stem cells (iPS-MBMCs) was rapid and efficient, with robust transcript levels of the pluripotency marker DPPA5 detected in the established iPS-MBMC lines [de Carvalho Rodrigues et al. DOI:10.3727/096368912X653048].