Basic Information

Symbol
DRD1
RNA class
mRNA
Alias
Dopamine Receptor D1 Dopamine D1 Receptor D1R D(1A) Dopamine Receptor DRD1A DADR
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_000794.5
Sequence length
4031.0 nt
GC content
0.4659

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1255.20 kcal/mol
Thermodynamic ensemble
Free energy: -1331.72 kcal/mol
Frequency: 0.0000
Diversity: 1317.19
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........((((((...((((((((((((.((((.((..(((...(((((((.((.((((((((((...)))))))(((.(((....((((((((...))))))))....))).)))..(((.((((..((((((.((((.((....)).)))).))).........)))..)))))))..(((((((((......))))).))))..(((((((((((.....(((....((((((((...(((...((((........((((.(((.((((((.((((.......)))).)).))))))).))))...((((.....))))))))))))))))))).......((((.((..(((((.(.((.((((.....))))..)).).))))).)).))))((((((((.(((((((((((((((....)))))...............))))).))))).))))).)))..........)))..))))))))))).))).)).)))))))...))).)))))))))))(((((......))))).)))))))....((((((((...)))))).))..)))))).((((((((((((((....(((..((((.........)))).)))..))(((((((((...(((((.(((((.((((......))))(((((....)))))....(((..((((..((((........))))..))..))..)))(((((.((((.(((((.(((..(((......)))..(((((.(.(((((.((......))))))).).))))).((((.(((......))).))))((.(((.((((((((((((..((((...((......))...)))).)))))))))).)).))))).....)))..))))))))).(((((.....)))))....(((((((((((((..(((.((...((((((...)))))))).))).))))).))))))))......(((((((.(((((.(((((.(((.(.((((......)))).).)))))))))))))..)))))))))))))))))..))))).)))))))))(((((((.(((((((((((.((((((((.((.((.(((((....((.((((((.((...((......))..)).))))))))))))).)).))..((((((...(((.((......)).))).(((((((((((.((((((((.(((((((((.(((((((..(((((((...(((((((((....((((((((((.(((((((.((((((((...........))).)))..))))))(((((....(((((......))))).....((.(((((((((((((((......((((((..(((((((..........)).)))))..))))))....))))))..)))......(((((((...))).))))..((((....(((((........)).)))...))))........(((((.((.(((((....)))))..)))))))...(((.......)))..))))))))..(((((.......)))))..))))))))...))))).))))).)))).)))))...)))))))..)))))))..........((.....))))))....))))).)))))))))).))))....)))))...))))))..))))))))..(((.(((((...(((((((.((....(((((((((..((......))..))))).))))...((((((((...(((((((((........((((((((((((((((((((((....(((........))).....(((((((((.((((((((((((((.((.((((.....)))).))..))))(((((.......))))).(((.(((((((((((......))))))..))))).))).....(((((((.....((((...))))))))))).(((((((((((((............((((((((((....((((((.....((((((((((((((((........(((((...(.(((.((((((((.......(((((....)))))..(((((((((.((...(((.((....)).)))((((((...))))))(((((((..............)))))))....(((((...)))))))))))))))).((((....))))......((((......))))..(((......)))...)))))))).))))..)))))..........((((((........))).))).((((.......)))).....)))))))))....((((((((((....((((((..(((((.((((...........((.((((........((..((((..(((((((........))))))).)))).)).......))))..))((((((((....))))))))..((((.(((((................))))).))))...)))).)))))...)))).))..)))))))))).......))))))).....))))))........((.....))...)))))))))).......((((((....))))))...........((((((....))))))))))).))))))))(((((((......(((((((....)).)))))..)))))))(((((.(((((((.((((((......)))))).))))......))))))))........)))))))))).))).))))))((((((.....)))))).((((((((...((((.((..((((.(((.((((((((((((.(((((((.......))))))))))))))))))).)))................(((((((.........)))))))..)))).)))))).)))))))))))))....)).)))))(((((......)))))))))))))))...(((((((...(((((...((((....).)))...))))).))))).))..)))))))))..(((((((............)))))))....)))).))))..............))))))))))))))...))).(((((..((((....(((....)))....)))).)))))....)))))))..)))).)))))))((((((((((((((((((...(((((...((((((((((((((....))))))).((((((............))))))......((((.(((((((((.(((...(((((.((.((((((((.......(((...(((((.....)))))...))).(((((((.......((((((..(((((((((.......)))))..)))).))))))......)))))))....(((((((.((.....)).))))))).((((((((((((((............)))).................(((........)))...)))))))))))))))))))).)))))..)))))))))))).))))..(((((..(((((.((((((((((((((((......))))..(((..(((((((((..(((....)))((((((......(((((((((........((((....)))).(((((((.(.((...)).).)))))))))))))))).....))))))...(((.(((((.......((((...(((((...))))).))))........))))))))....(((((.((((.....))))...)))))......))))))))))))..(((((...)))))...(((((((((.(.......)))).))))))......)))))))))))).))..))).)))))(((........)))........)))))))....)))))..)))))))))........)))))))))............)))))).))))))....((((.((((....)))).))))........
Thermodynamic Ensemble Prediction
,.{,{{{.,{{{||||{,(((({(((((((.((((.((..(((.,.(((((((.((.((((((((((,,,||||}||(({.(((.,..((((((((...))))))))....))).))),,|||.,((,..{||(((.((((,((....}),)))).}))......}}})))}.}))))))..(((((((((......))))),,))).,(((((((((((.,{{{{{|,,..((((((((...{{{|,.,.,{........((((.(({,((((({,({{({{....)))}}})},))))))).))))..,((({.....}}))}}..,||}}}|||||,.....,(((({{({{(,(,,.,.,|}|}|,|}}}}}}}||,||,}||||}}.||,|}||{((({,,,.,,,{{||||||||||,,,,))))}.........,,|...||}|}.|||||{|||,}.}}}..}.}))),,)))..))))))))))).})).)).))))))).,.))).))))))))))}{{{||......}}})),))|||}|....{,((((((...}))))).}}..,,,,(({({{(((((((((..{(({(,.{{,,(({.,,,,,..|||}{(((.(((((((((((((((,((((((...,(((((,....{||,,,,||}|{.|||||,,,|,||{{{{|||.,({((,.,,,,,.))))..||,{|,,..||{,,(((((((((((((((({.,(((((.,...,{..{{(((.,.{{{||,(({{{{{.|{|((||.,....)),})))))))}{{{{.||{{{{.(((((((((.(((.((((((((((.....((((,{{{{..{{|((((((({{,{(((((|{{|||.((...((((((..{(((((.{((((.....))))}....}))))|))))))...}|.}|.}}.||||||,..{||||{||(((|.|.,.|,.,,||}}|({{{{.(((((((.,((((.(((((.(((.{.((((......)))).}.))))))))))))}..)))))))|||||{.,,((((((((((({..,|{|,,{({((,.{({.,|,|{,(({{....{(((|,,.{{{||,,||((.(((((({(({.{{.....}.)))},,.)))))))))}|||,||||||,}}}||||{{,,,,||||}||||,.{|{{||||||||||,|,,,,})))})},}}(((((...)))}),...,},....,,,||||||}}..,||,.....{(((......)))},,,,||,||}}}..,)})},.}}))))))))))))..,{(((((.{{{{{||||}...,.}},.)),)))).}}.,....)}}}}}}}}}),}||||.,,,},,,,,|}}||},|}...,}|||,},.}}))}}}}}},,...}}}|,}|}}}...))),))))}.(((,....{,,...}}},{.,},.,))...,)))})))))))))).)))(((((.((((..,|.((((((((((.,{((((.(((((.((((((.{,,....(((((.......))))).....}})}....(((({..,(((((.{{{.,{((.(((.(((((((................((((.(((((.(((((....))))).)))))...)))).....,,,{{{,{,{...((((((........)))))).|..,},|||,....}},.{{(((((((..((......))..)))))}},)}..))))))).))),))))}.)))))))))))))).)).))))).))))}))))....,{{,,,.....((((((((..((.(((({({((((({{(((((,{{,(({(,,,,.}||}.||,,|,}},.,{||...,,,..((((((((((({((((((((....{(((.,..}))}.)}}}}}....(((((((,....{{{{...,}}))))))))..,,,,,{{{{{{||}.,,,...,|,{{{{||||||.,,.|,,,,,.,||,|{{{{{{||||{{{|||,,.....,{{{(||.|,({{.{{{|||{|,,.....(((((....)))))..(((((((((.((...(((.((....)).)))((((({...})))))(((((((..............)))))))....(((((...)))))})))))))))).((((....))))......,((((({......)))))},,,,||||||||||||||||,|}}|,,||||||.........{{(({{........))),.}},((((.......))))....,|||}||,||{{..,{{((((((,,.....||||}}{{{({.(({{...........((,({((.{,,....{{..((((..(((((((........))))))).)))).},.....}.))))..)}{(((((((....)))))))},{(((({((,,,...,,,......}}},)))},,||,|,,,}))),|||||,.,|||}.,,,.)))))))))),.,,,.,}}}}}}},,...,,}}}},,,,|,,}}|}},,.,,...,))))))))}.......((((({....})))))...........||||||},,,}))},}})}))}))))))|,(((((((......(((((((....)).)))))..))))))){{{{{.{{{{(((.((((((......)))))}.))}}......}}}}}}))......,,,||{{{{|,,|.||||||||,,..,,}})))}||,..,,{|||||{{..,((((.{{.,((({.(({.((((((((((((.(((((((.......))))))))))))))))))).})}...,,,,.....,,,,(((((((.......,.)))))))..}}}}.,,}}}}.}}}}})))}},.......,,.,}}}|||||,}}}},}}},}}}}}}}}}))))}}(((((.((.((({...,((,..{((({..|,...})..))))))})))).)).)))))...(((({..,((((....{{.||,.{((((((...(((((((((.....,((({.,,.....}}}.},...(({{{{..,,,{{{{{{{{({..||,}},,||,}}}},},,,},,..|||}}}}}.,,,.)))))))))....)))))))..}}}}..,))))))))))))).))..)))))))).,......,{{{,,.....,,.....}}}}))|||,..((((.(((((((((.(((...(((((.(,{((((((((,......(({...(((((.....}))))...))).(((((((.......{(((((..(((((((((.......)))))..)))).))))))......))))))).,..(((((((.((.....)).))))))).{(((((((((((((............}}}|,................||{........,}}..})))))))))))))))))))).)))))..)))))))))))).))))...,,....))))))..,,..)))).}))))......{{{{.....))))))))))))).)))))))))}.{,(({.{{||((((,,{,,....}}}}||||.,},,}}}.(((((((.(.({...)).}.)))))))}}}}}}))))))))))))))...{((,(((((......,((((...(((((...))))).))),,,......))))))}}....,,,.........)))))))),,},|||,....,{||||{((((((((.(((...})))))))))))}}.,.,,}.}}}}}}}.,},}}}})}.}}...,,,.,,}}}))}},)}}))))))}..{((........))).........)))))).....))))).)))),|||||},..,))}},)))..})...}})))...)))))).))))))},..((((.{(((....)))).)))).,,.....

Transcripts

ID Sequence Length GC content
GUGCGCUUGCUGGUGCCAGCUCGGCUCGCUGCCUCGCAUUGCCACAGGC… 4031 nt 0.4659
Summary

This gene encodes the D1 subtype of the dopamine receptor. The D1 subtype is the most abundant dopamine receptor in the central nervous system. This G-protein coupled receptor stimulates adenylyl cyclase and activates cyclic AMP-dependent protein kinases. D1 receptors regulate neuronal growth and development, mediate some behavioral responses, and modulate dopamine receptor D2-mediated events. Alternate transcription initiation sites result in two transcript variants of this gene. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the DRD1 is a striatal marker enriched in the nucleus accumbens of unaffected comparison subjects [Seney et al. DOI:10.1016/j.biopsych.2021.06.007]. In mice selectively bred for differential methamphetamine consumption risk, the DRD1 showed high expression in the nucleus accumbens, with its differential wiring in the prefrontal cortex identified as part of synaptic alterations associated with addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155]. A separate review noted that upregulation of the DRD1 in cardiomyocytes triggers life-threatening ventricular arrhythmia by driving dysregulated calcium handling in the failing heart [Yamada & Nomura DOI:10.3390/ijms21218345].