Basic Information

Symbol
DSC1
RNA class
mRNA
Alias
Desmocollin 1 CDHF1 Desmosomal Glycoprotein 2/3 Cadherin Family Member 1 Desmocollin-1 DG2/DG3
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_024421.2
Sequence length
4225.0 nt
GC content
0.4163

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1152.80 kcal/mol
Thermodynamic ensemble
Free energy: -1234.24 kcal/mol
Frequency: 0.0000
Diversity: 1053.03
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...........(((((((((((........))))(((((.(((((((...(((.(((((((((((...(((((((.....)))))))..((((((((.(..((((((.(((..((((((.(((((((((((......(((...)))(((.((.((((((...((((.((.(((.((....))))).)).))))..)))))).)))))....((((....))))....((((((((((((((........)))))((((((((..(((....)))...(((((....(((((...)))))....)))))....(((((.(((((.(((..........((((((.(((((((...(((........)))(((......)))......((((((....(((((.(((((...(........)....))))))))))....)))))).....((((....))))..((((.........((((((((((...(((((.........(((....)))((((.(((((((((((((((.........))))))))))))).)).))))(((((..(((((...........))))).)))))...............(((((.......)))))..............((......))((((((..(((.(((..(((.....((((.(......).))))((((..((((((.......)).))))..)))))))..)))...)))..))))))...)))))...))))))))))..........))))))))))).).)))))...(((((((((((...((((...(((......(((((.((.(((((((.......((((.((((....((((((((((((((..(((((...(((((.(((((.....((((........)))).((((((((............((((((.........))))))..............))))))))....((.(((((......))))).)).(((((.....(((...)))...))))).(((....(((.....)))...)))....((((((((((((.(((((...((.(((((((((............(((.((((((.((((((.....((((((...........((((((...(((.(((((((.........((((((......))))))((((..(((((.(((........))))))))....))))(((((((.((((....)))).........((((..(......((((((.(((((((((.......(((.(((((.....(((.......(((((..(........)..)))))......))).....)))))((((((((........)))..))))).......(((..................)))))).......))))).))))))))))...(((((...))))).....(((((..............((.((((((..((((((((((...((.(((((.((....))))))).))(((.((.......)).)))(((((........)))))...........))))))....)))).)))))).)).))))).((...((((((...............))))))....)))..))))...)))))))(((((((.....((((((((((.....(((((........)))))...))))..)))))).....)))))))...(((....))).))))))).)))....))))))))))))....)))))).......((..((((......))))..)))))).)).)))....(((((...........))))).........((((.....))))........))))))))).)).....))))).((((.(((((.(((((.((..........((((...(((((((.((((...((((.(((((.((((((...(((((((..........)))))))..(((((.((((((((((((((.............(((((((.(((..((((((.((....))))))))..))).)))))))..((((((((((....)))))....)))))...((((((((((....))))))))))....)))))))))))))).)))))(((((.....((((((((..((........)).))))))))..)))))..((((....)))).....)))).)).))))).))))....(((.((............)).)))................))))..)))))))...)))))).))))).)))))...))))...))))))))))))))))).))))).)))))..)))))..)))))))))..)))).))))..(((((((.........)))))))))))))).))..))))).....)))...)))).)))))..))))))))).))))))))))...)))))))).......(((...(((.((((((((.(.....((((...))))).)))))))))))....))))))))))))))))(((((((........))))))))))))))...))))))((((((((((((((((.......((((.........))))))))))))((((((.(((.(..(..(((((((.(((.(((...(.((....)).)))).))).))))).)))..))))..))))))...))))))))...)))))))))..).))))))))........((....)).((.((((((((((....)))))..))))).))))))))))))))))....((((((....)))))).((((((((((((((.((....((((((.(((..((((((.......))))))......(((......)))))).))))))....)).))))))....(((.......)))...((((..(((((.......)))))))))((((((((((((...))))))))))))..((((((....))))))..(((((.((((((..(((((((.((((.((((((((.......(((....((((((((((...(((......)))..)))))...)))))...)))........))))..........)))).)))).))))))).......)))))))).))).)))))))).))))))).)).)))...((((((.(((((........)))))))))))((((..(((((((.((((((((((((..(((((((((((.((((((((.(((.((((...(((((...((((((..(((((..((((((((((((((((...))))))))).(((((.........))))).))))).)).....)))))...)))))).)))))))))))).))))))))..)))).....((((......))))........((((....)))).......((((((((((...))))))))))))))))).((....)).((((((((.((((((((((((((...(((((.((((((.(..((((.((.....(((((((...))))))).....))))))).)))))).)))))))).....((((((((...(((((((.(((((.........))))).)))))))...))))..)))))))))))).))))))).....)))).....((((((......((((((....((((....((((...((((......))))....))))...))))........))))))..)))))))))))(((........)))(((((((((((...(((((....)))))...(((((((((((((((((((.(((..(((((.....)))))....))).)))))...)))((((...((......)))))).............((((..(((((..(((.............)))..)))))))))...))))))).)))).........(((.........)))........................)).)).))))))).....)))))))))))))).)))))))))))(((((.((((..((((((...((((((....((((..(((((((.((.......)))))))))))))..))))))......))))))..))))))))).................
Thermodynamic Ensemble Prediction
...........((((((({{(({..{{{..{|,,.{{,,.{(({(((...(((.(((((((((((({.(((((((.....)))))))..((((((((.{..((((((.(((..((((((.((((((({,,,......{({...||{(((.((.((((((...((((.((.(((.((....))))).)).))))..)))))).)))))}...{{{|,,..})))...,((((((((((((((........)))))((((((((..(((...,||}...|||||,..{((((({..|||,,..,,),,))}}},|((((.(((((.(((........,.((((((.(((((((,,.,,,,{,....|}},(((,,,...|}|.,,,,{{{{{|{...{{{{{|,,{{|,,,|||{,((((({((((,(((,{,,{{,(({{,{......,,||||..,.))),}}.}||||}},.,,}{{{{{{{{((.,.{,,,,..........||,,,,},,{{(({(,(((((((((((((.........))))))))))))).)).)))}(((((..(((((...........))))).)))))..,..,,,.......(((((.......)))))........,.....{{|,,|..||{{{||,.,{|,.||{|||||.....{{{{,{......).}))}((((..((((((.......)).))))..)))).,{{{{||...)))}.)))))}.,.}}}},...||}}}}}}}}.,|||,,}})))},})))))).).)))))...(((((({((((...((((...,{{,,....(((((.,,.(((((((.......((((.((((....((((((((({((((..(((((..((((((((((((.....)))}..)))))))}...{{({.,,,.........,,,((((((.........)))))).,,|,,||,,.,,||}}}}}},..{,((,(({((......})})),)).{((({.....(((...)))...)))))||||....{{{.....))).......,{{((((((((((({.{(({{..,{{,((({{{{{{............{{,.{{((((.((((((.....((((((...........((((((...(((.(((((((.....,,,.((((((......)))))}{{||,.(((((.(((........))))))))....,},}((((((({((((,,,.}|||.........{{{{..,......{(((((.((((((((({,,,,{{....,,,,,|,|,}|||......{(((((..,.....}}})}}....,...{{{{..,|||.|||||{,|{||,{|,,,...|}}...}}))),{{|}}||....,..,))}},,,}},,,,,)))).......))))).))))))))))...{{((,...|}}||.....(((({....,.........{{.((((((..((((,((({{...{{.(((({,((....))))))),||{{{,{{...,,|.,|{||||||{{......|||)),},,,},,,....}}})}}}}}.)))}.)))))).},.)))))......((((((...............)))))),,}))))},}}))...)))))))(((((((.....((((((((((.....(((((........)))))...))))..)))))).....)))))))...(((....))).))))))).)))....))))))))))))....)))))).......|{|,((((......))))..},)))).)),})),||.{({{{.......,.,.)})))..,,,,...{(((,....||||....,,..}})))}}}),}),,,,,))))},((((.(((((.(((((.((,,,......,((((,,.(((((((,(({,...{(({.(((((.((((({..,(((((((..........))))))),.(((((.((((((((((((({.{{........,,(((((((.(((..((((((.((....))))))))..))).)))))))..{(((((((((....)))))....))))},,.{(((((((((....))))))))))..}})))))))))))))).))))).,{,(,{{..((((((((..((........)).))))))))..))))|,.{{({....})}}.....)))).)).))))).)))}...,{,|}|||}}}}},,,,,||..,,,,...,||,,..,.,,{|||...}}})))),..}})))).))))).)))))..,))))...)))))))))))).}),,,}))))})))))..))))}..))))))))),.)))).))))..(((((((.........)))))))))))))).}}..))))).....}}}...)))).)))))..))))))))).))))))))),...)))))))).......{{{...(((.((((((((,{.....,{{{...,,,,).)))))))))))....)),)))))))))),}.{((((((........))))))))))))))...))))))((((((((((((((((......{{({(.....,}..})))))))))))((((((.,,{,((({..(((((((.(((.(((...(.{{....)).}))).))).))))).))}..))))..))))))...))))))))...)))))))))..}.))))))))...,,...((....}}.|{,{{((((((((....)))))..}))}}.))))))))))))))))..,.((((((....)))))).(((({{{(((((((,{({{{.(((((({(,,..,|||||},}},..,}}}}}.,,,.,(((,,,,,,||||||.,,,,,}....}|,|}|}}}....{{{|,.....}}}.}}||||,,(((((.......))))))}|{((((((((((((...))))))))))))},||{{{|,,,,}}}}})..{((((,((((({,.((((({{.{(((.((({((((.......(((....((((((((((.,.(((......))).,)))))...)))))...)))..}.....}))).....,,,,})))).))}}.})))))),,,....))))))}}.}}},))))))}).}},)))).,)))}}...|||||{.{{{{{.,,,,,..}}}}})))))}{(((..(((((((.((((((((((((.{((,{((,((((.((((((((.(((.((((...(((((...((((((..{{{{(.{((((((((((((((((...)))))))))}{((((.{.....,.))))}}))))),||.....)))}}...)))))).)))))))))))).))))))))..)))}..|||((((..,,,.}}}}........{(({....}))}..,...,((((((((((...))))))))}||{{{{{{(((..{{{(,{.{,{{{(,{.|||||,((((((((...{.((((((((((.,({{,.,,.....((((,,((((((({......})))))))}}))..,.}}.)))))))))).}.)))))))).{{(((((.....,.}}}}})},),..))),))))))},..,{{{|{|||,,,,,)}.)))))),,|||.{{|||,,,..(((((,..,(((((.{,..,{((,,...,,||....,,,,......}}}},...,,)))))))))}}.......))))).}}}))).))))){((........))}(((((((((((...(((((....))))},,.((((((((((((((({(((.(((..(((((.....)))))....))),))}},..,)))((((...{{......}})))).............((((..(((((..(((..........,..}}}..)))))))))...))))))).))))..,}|....(((.........})),.,,,..............,,,..)).)).))))))).....)))))))))))))).)))))))))))(((((.((((..((((((...{(({{{,,,,((((..(((((((.((.......))))))))))))).,))))))......))))))..))))))))).................

Transcripts

ID Sequence Length GC content
ACUUGUAGGAAAGCCUCUUUGCAUUUAGACGUAAUUGAACUGGAAGGAA… 4271 nt 0.4151
ACUUGUAGGAAAGCCUCUUUGCAUUUAGACGUAAUUGAACUGGAAGGAA… 4225 nt 0.4163
Summary

The protein encoded by this gene is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. A subtype of IgA pemphigus, a life-threatening autoimmune disease, is characterized by the presence of autoantibodies that target the encoded protein. The desmosomal family members are arranged in two clusters on chromosome 18. Alternative splicing of this gene results in multiple transcript variants. At least one of these variants encodes a preproprotein that is proteolytically processed to generate the mature protein. [provided by RefSeq, Nov 2015]

Forensic Context

A study in humans demonstrated that the DSC1 was evaluated as a candidate mRNA marker for skin identification in forensic samples [Visser et al. DOI:10.1007/s00414-010-0545-2]. The investigation, which tested candidate genes ascertained from expression databases, found that the DSC1 showed non-specific amplification among the tested samples and was therefore not selected as a suitable marker for distinguishing skin from other forensically relevant body fluids. A study in humans demonstrated that the DSC1 mRNA, evaluated for inferring whether an object was handled or touched, showed a low detection rate in skin swabs but its expression levels were well separated from other body fluids [Akutsu et al. DOI:10.1016/j.legalmed.2018.05.003]; however, it exhibited low detectability in mock casework samples such as mobile phones and doorknobs, limiting its practical forensic application [Akutsu et al. DOI:10.1016/j.legalmed.2018.05.003].