Basic Information

Symbol
DSC3
RNA class
mRNA
Alias
Desmocollin 3 CDHF3 DSC1 DSC2 DSC4 DSC Cadherin Family Member 3 Desmocollin-3 Desmocollin-4 HT-CP
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001941.5
Sequence length
7583.0 nt
GC content
0.3919

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1989.20 kcal/mol
Thermodynamic ensemble
Free energy: -2147.22 kcal/mol
Frequency: 0.0000
Diversity: 1860.72
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.............(((((..((((((.((((...((((((....((((.(((((((......(((((.....(((....)))..))))).))).)))).)))).((((((....)))))).(((.((..((....)).)).)))......(((.....))))))))))))).))))))....))))).......((((((..((((...((((((((((......(((((((((.(((((((.....((((((((...((((((((.((((....(((.(((((((((((....)))...........((.((.(((((((.(((((....)))))))))))).)).)).......)))))))))))......(((((((.................))))))).((((.(((((((((......((((((...((.(...(((((.....(((.((.(((((....))))).)).))).(((..(((((.((((.((.(((((((((.....))))).)))).....)))))))))))..)))..)))))....).))...)))))))))))))))))))...(((((.((((((.....)))))).((.(((((((...(((.((......(((.((((.....)))).)))....))...)))...))).)))).))((((((((((((.....))))))......((((((.(((..(((.((((.......)))).)))..)))))))))........((.((((((....)))))).)).........(((((((((((..((((.(((((.(((.........)))...)))))))))((((((.......))))))....))))))).)))).)))))).(((((((((...((((....((..(((((((.(((((........))).))))(((..(((.((...)))))..)))...((((((......)))))))))))..)).....)))).))))).))))))))).)))))))))))))))))))).......((((...((((((.....(((((((.(((.........))).))).))))..))))))))))....((((.(..((((.((...((((((....((((...(((((.(((((...)))))))))).))))....))))))..)).))))..).))))((((.(((..........)))))))))))))).)))))))))(((((((((((((((((((((((((((((((.((.((((..((((..((((((((((((((..((((.....(((((..((((..(((((((((.....((((.....(((........)))..))))...(((((((((((((((.....(..((((.....))))..)..))))))..((((((((((((((..((((.(((...(((((.....)))))))).))))..)))))(((((.(.(((....(((((..........)))))....(((....))).))).).)))))...((((((((((((.((........(((((..........(((((((..((((..((((((..........((((((........))))))...((((.......))))((((.(((((............((.((((.(((((.......)))))..........((((......)))))))).))............))))).)))).)))))).))))..)))))))............((((((((((.........(((....)))...........))))))))))..........))))).........)).))))))))))))..........((((((((..((((((........((((((((......((.....))......))))))))))))))(((((((.((((........))))(((((...((((.((((((..(((((((((......((((.....))))...(((((((...(((((((((((((((((((((((...........((.((...(((((((...(((((((......((....(((....)))....)))))))))..((((((((..((((((.(((((.....(((.(((((....))))).))).))))))))))))))))))).......(((((..(((((((..((((..((..((((((....))))))..)).....))))...)))))))...)))))...)))))))...))))(((((((((((((....)))).((...))((((.(((((((...(((((.(((.(((.....)))...))))))))...)))).))).))))...((((((((((((((....((((.....)))).....((((..(((.....)))..))))(((((((((.((((.....((((..((((...(((((((.((((((.(....(((((((((..((........(((((.....)))))(((((((.......(((((((((((..((((((((((((....))))))(((((((....(((((.((((.(...(((((...((((((..........)))))).....)))))...).))))..)))))(((.((((..(((((((((((...........)))).)))))))...(((((((...)))))))..........)))).))).((.(((((((..((((((.(......))).))))..)))))))))..)))))))(((.(((.(((........))).))).)))....(((.(((((....))))).))).(((.(((((((((((((((..(((......((((((.(((((((((.((.((((((((((((.((((((((((((.((((((((........((((....(((...((((.....((((....))))....))))..))).....)))).........))))))))(.((((((.......)))))).)(((((........)))))....((((........)))).....((((....)))).(((((....(((((((.((......................)).)))))))..))))).....))))))))))))....((((.(.((((((............))).))))))))........((((((((.(.(...(((.((.(((((.((....)).))))))))))....).).)).))).)))....)))))))))))).)).))))))))))))))).....((((((......)))))).............)))..)))))))))....)))))).))).((((.((((((...((((((....(((((.(((((((((...(((......(((((((.((((((.(..((((..(((.((((((...((((((((..........(.((((.(((((.((.(((............((.(((((((((((......))))))))))).)).....(((((.((((((((.((((.((((((...(((((((....(((((((....((((((((......)))...))))).......((((.((((...((((((((....((((.((.(((((...(((((((.......))).)))))))))...)).))))..))))))))...)))).))))...........................))))))).....)))))))...)))))))))).)))))))).)))))..((((.........))))......))).)).))))).)))).)(((((((...(((((((.(((((((((((((.....))........((((((.(.....).))))))......(((((((...(((((((....).)))))).)))).)))............))))))))))))).))))))))))))))))))))(((((((...(((((((((((((((((((((.((((((((((..((.((((((((..((......))..))))))))...))..)))........(((.....))).......(((.(((.((((...))))))))))((((((((((.......(((((((((.((((............(((((......))))).............)))).)))))))))(((((....)))))))))))))))((((..(((.(.....).))).....((((((..((......))...))))))..)))))))).).))))))))......((((.(((((((.(((((........)))))..))))))).)))))))))))).......)))))))..)))))))((((((....)))))).)))))))))..))))(((((.....((((((..((..(((((((.....)).)))))..))..))))))....)))))(((((((((.(((....((((.((........))))))..))).)))))))))........(((((((((((((............((((((...((((.......))))....))))))))))))).....))))))(((.........))).........).)))))).)))))))........(((((((......))))))).....)))...))).))))))....................(((((...)))))((.(((.....))))).(((((.(((((((..........)).)))))...)))))))))).))))))...)))))).))))..(((((....)))))((((((((......((......))......))))))))..........))))))...)))))))))))..)))))))....(((((.(((....)))))))).....))..))))))).))...)))))))....))).))))...)))).)))))))).).))))))))))))))))))))))...))))))))).......((.(((((((((.....((((((.......))))))((((((....((((((.((((((.....((((((.....(((((((((((((((((..((..((((((.((........)).))))))...((((...((.((((......)))).))...)))).........(((.((((.(((......))))))).)))((((((.....))))))..))..))))))).......................(((((((..(((((((..((.(((((....(((((..((((((((..((((..(((((..........................(((((((....((((((((..(((((.((((.(.((((((........((((((.(((...(((((........))))).......))).)))))).....(((((((((.(((((..((((((((.((((((((((....))))))..))))..))))))))...)))))...))))))))).(((((((...((((((........))))))...)))))))........(((....)))(((..(((((((((((......)))))))).)))..)))...))))))).))))..))))))).))))))..)))))))((((((((....)))))))))))))))))))))))))..)))))......((((((...))))))...)))))))..)))))))..............)))))))...(((((......)))))...))))))))))))))))..)))))).))))))...))))))))))))))).)).))))).......)))..))))))))(((((....(((((.((((.(((((..(((((.....(((((........((((((.............))))))(((((...((((....))))..)))))((((((((((((((....((((((((((..(((.(.(((.(((((...))))).))).).)))....(((((((.....)))))))((((((....((((.(((.........)))..))))...))))))..(((((((..((((((......))))))..))).))))..(((...(((..((((.((((.....((((((.((((...((((((.............)))))).)))).))))))..))))..))))...))).))).(((.....)))...)))))))))).)))).))))))))))...(((......))))))))))))).....))))))))).))))).....)))))...((((((.((((........)))).))))))((((((.......))))))(((((((((((((..((....((((((....))).)))....)))))).))).))))))..)))))))...)))))))......((((((.......)))))))))))))))..))))))))))...))))).....))).))))...))))))))...((((......))))((((....)))).....)))))))))..(((((((((..(((((.(((((((..............)))))))((((((..(((((.(.((((((.(((......))).)))))).).))))).))))))..........)))))))))))))).(((((((.(((((.((((.....))))..))))))))))))(((....((((((((..((.(((.(((...((........)).(((((....))))).....))).))).))..)))))))).)))......))))))))))))))))))..)))).))))))))))))))))))))))).....))))..))))......(((((........))))).....((((.((.((((.....)))).)).))))......((((((((((.....((((........))))(((((...)))))..........((((((.....(((....)))..))))))(((......)))..(((.(((((((((((..((..(((((......)))))..))...)))))))))))..)))))))))))))(((.(((((.(((((((((((......))))).......))))))..)))))))))).))))))))))......))))))))))))..........)))))..(((((((.(((((.....))))).)))))))..((((((((...............)))))))).....((.((((((.((((.(((..((...))..))))))).)))))).))...(((((((....................)))))))...))))......((((...(((...)))..)))).....))))))))))))))..((((......)).))(((((....)))))...)))))).
Thermodynamic Ensemble Prediction
.....(((.(((((......)))))...)))((((((((.......((((({{{,((((,{{.(((((.((.((((...,....})))),,)).))))),,||,((((((....)))))).((({(({{((....||.||,|||,..,{{{,{,.,,,|||||||,|||,.,||{{}},..,||||,.,{|....,}}}}|||{{,...}}))))}}}))....,(((((((((.(((((((..,,.((((((((...((((((({{((((.{{.((({(((((((((({...,|||,,.,{{,,,{{((,((.(((((((.(((((....)))))))))))).)).}}..,....}}))}}}},||....}}{{{||||.....,},,..,.,,..}|}}}||,((((.(((((((((......((((((...{,.,...(((({...,.(((.((.(((((....))))).)).))).(((..(((((.((((.((.(((((((((.....))))).)))).....)))))))))))..)))..)))))......})...)))))))))))))))||||.,,(,((({,(({{,.....)),)))})}},}}}}...,.,.}}}}}}}...|||||||,...,,,..{(((((..(((...,,,..,,,.{{(((.|.(((((({{(((,,,,{,||,,,),}}},,{||(((,(((,.{{{,||||,...,,,|||}.}}}..}}})}}))),,,..,{{(,.((((((....)))))).)),.,......{((((((((((..((((.(((((,(..,{{{......))},})))))))))((((((.......))))))....))))))))}})).)))))).}.))).}}....||,.....{{,.{(((({,,{(,,,....||..,,},},},(((..(({,((...)))))..)))...((((((......))))))))))}..,.)))..)))))),,))))}))))),)))))))))))))))))))))).,|,...{(({..,((((((.....(((((((.{((.........)},.))).))))..))))))))))..,.(({..((((((,.,{,..{(((((....{((({..(((((((((((...)))))))))).))))....)))))),..,.}})},,)))})){(((.(((.{......},)))))))))))))).)))))))))|{{{,|{{.,{{{{.,(({(((...,,||||||,}}}}.}}),))))....,,,{{(((({..{((({(((......))).})))}))))},}}.....{{{{|,....||,,,....,}.)},})}),,}}}}}..{,{|},|....,,,},..)))))...)))).)))}.....((((((((.,,,,,.,({{(,{{{{..,{|||.|,|,,,|{(({(((((...(((.((((((..(((.(((..,,({(((..........))))),....,,....||,....,|(((({....((((((((((((.,{,,..,,{.(((((,.........(((((((..((((..((((((.....,,,,.((((((........)))))},,.,{{{.......)))}|||{.{{{{{....((((......))))..(((((.......)))))......,,.{((((......))))||},{{,...},,.,...,||}},.,))).)))))).))))..))))))).....,{,....((((((((((.,,......{{,....}))........,}.)))))))))).........,))))),},....,.},.)))))))))))).,((((({..((((((((..((((((........((((((((......,{,,...,),,....))))))))))))))(((((({.{(((........}))}(((((...((((.((((((..(((((((((......{{{{.....)}))...{((((((...((((({|((((((((((({,{,.,.,.,,..|||{{{(({..(((((((,..(((((((......,{,.{{{{,.,,,}}},...,,))))))}..((((((((..((((((.(((((.....(((.(((({....))))).))).)))))))))))))))))))..,,,,.{{{{{|.(((((((,,(((({{((..((((((....})))))..}}.,,,.))))...}))))))...}}}}}...))))))),,,...,(((((((((((((....)))).{{...,,((({.(((((((...(((({,(((.,,,......})},.})))))))...)))).))).})))...((((((((((((((....((((.....)})}...,,((((..(((,...,)))..))))(((((((((.((((.....({{{..((((...(((((({.((((((.{....({(((((((..,{........(((((.....)))))(((((((.......(((((((((((..{,((((({((((....|}|},|(((((((....(((((.((((.{...(((((...((((({..........)))))).....)))))...|.))))..)))))(({.((((||{({((((((((.......,..})}}).)))))},{{{(((((((...))))))},}}}.,,,,.)))).})).{(.(((((((..((((((.{......})),})))..))))))))}..)))))))(((.(((.(((........))).))).))).,..(((.(((((....))))).))).,|{.(((((((((((((((..(((......(((({{{(((((((((.((.((((((((((((.((((((((((((.((((((((.,..,,..{((|...,{{{...{{{{..,..((((....)))).,,.}))}..}},.{{,.}}}),,.,,....)))))))){,((((({,,,...,}}}}}},}(((((........)))))....{(((........)))),,,..((((....)))).{((((....(((((((.((.,..................,,)).)))))))..))))).....))))))))))))....((({,(.((({({............)}).))))))))........((((((((,,,....(((.((.(((((.((....)).))))))))))....}.).)),})).)))....)))))))))))).)).))))))))))))))).,{{{{,{(((,,....})))},,,},,,.......)))..)))))))))....)))))).}}},((((.((((((...((((((....(((((.(((((.((((..((...,....|{((((((((({(((((((((.(((((,(((,,......}}}.,.......{((({((((.(((((.,,.{{|.,,.........((.(((((((((((......))))))))))).)).....(((((.((((((((.(({{{((((((...(((((((,,{{{{(({,,,...,||{{{||,,,,,.}}}|,,|||}|,,,....((({.((({...,{((((((..{{{((|.,,}|{|||}},|||||{|...,,.,))),,)))}})}}}},||{||||{{|}||||||,,,|}||.,,,,.,,,....,,,.....,,,.}}},.,}))))}})...,,))}))))...)))))))))).)))))))).)))))..{{{{.........)))}......}}}.}}.))))).)))).))))))))))..)))))))),.((((.((.,{.....{,,||,....{(((((,(.....},}}}}}}......(((((((...(((((({....}.)))))).)))).)))...,........,,,|||((((((((,,{((,....|||{|,|((((((((((...((((((((((((((((((((({((,,((((({..,{.((((((((..((......))..))))))))..{||{{|{{.{.{{...,(({{{{{.....{{{{{.({,(({{{(({...,}},},,|}|((((((((((.......{((({,,,,.,{{,..,,..,....,||||{{,,...,,,..........}}...,}})}))))),,,.(((((....)))))))))))))))||,,..,,|}}}}}.,},},}.},,.))))).....))))))),..}}}))},,})))}}))),).)))))))||,....{(((.(((((((.(((((........)))))..))))))).))))}))))))).......)))))))..)))))))))||,|..,},}}},..)})..))))))))},(((((.....((((((..((..(((((((.....)).)))))..))..))))))..,.))))){{(((((({.(((,,,.((((.(({,,,.,,,,||)))..})).)))})))))........(((((((((((((............((((((...((((.......))))....))))))))))))),....}))))).{{,,{{{,...{{|,,.......,,.....,}},,}}.....,},..{{{||||}...,.))))))),.})))))},.)}},,}),}},}}}}},,.))))))))))}(((((((((((,((((((,..({....)},)))))).,,.})))))).)))).}}..))))...)))))))))).))))))...)))))).))))..(((((....)))))((((((((......((......))......))))))))......}}}}}))))....)))))))))))..)))))))....(({((.(((,...,}}})}}),})}}})}.))))))).)}..,)))))))....})).))))...)))).)))))))).}.))))))))))))))))))))))...))))))))).,..{((({..,||||,|}|,|,,.{{{,((((,,((((((..((((((....((((((.{(((((.....{{((((,,,..{((((((((((((((((..{(..((((((.((........)).))))))...((((.,.((.((((......)))).)).,.)))).........(((.((((.(((......))))))).)))((((((.....))))))..})..)))))}}.......................(((((((..(((((((..{{{(((({....(((((..((((((((..((((..(((((...{{{,...,,,,............(((((({....((((((((.,(((((.((((.(.((((((,....{,,((({{,.,{{||.,{(((........)))}}...,},,},})))},,}.....(((((((((.(((((..((((((((.{(((((((((....)))))).}}}}}..))))))))...)))))...))))))))).{((((((.{.((((((........)))))).}.))))))).......,,,,..,,,||((,.,(({{{((((((......))))))))}),)}}),,...))))))).))))..})))})),,))))).,))))))){(((((((....)))))))})))))))))))))))))..))))).}},,,((((((...))))))...}}}}},}..)))))))....,,........)))))))..|{{,,,......,,,,..,,))))))))))))))))..)))))}.))))))...))))))....)))))))))))})}......,)),,.})))))))(((((....(((((.((((.((((({((((((.....(((((......,.((((((.............)))))),{{{,,{,,,,,.....,}}}.}))}}((((((((((((((....((((((((((...{,,{.,{(,(((((,.,|||||.,,}}}}|,,....{((((((.....))))))}{{{{{{....((((,,{{..{{....,}},|,||}}...}}}}||,{(({({((,,({{{{{.,,,,,}))}}),,))).)))).,|||...{{{..((({.,{{(.....((((((.((((...((((((.............)))))).)))).))))))..))))..))))...})).))).{{|.....))),,,)))))))))).)))),,))))))))),,,{{|...}}})),))))))))}}})}..))))))))).))))).....)))))...((((((.{(((........)))}.))))))((((({.......))))))(((((((((((({..{{....(({{({....}}),}})....}})))}.))).))))))..}))))))...))))))}......((((((.......))))))}))))))))..))))))))))...))))}.....)))}})))...)))))))}..((((((((((({((((.((.((.((((((((..,((({{.....,,,||||}}},,,,,.{((((((..............))))))}((((((..(((((.(.((((((.(((......))).)))))).).))))).)))))).,,{{......,,}))}||||}||.(((((((.(((((.(({{.....))))..)))))))))))){{{..,((((((((..,,(((((((.....,.(({{..,....(((((....)))))......,,)))).....,,))),,)}).,..))))))))||||.....}|||{..{{.....,},}},,||,|||{(,({,...,,,,}}},))}}}.}}....{((((........))))))))))))).)).)).)))){{({|(({({{,{{,.....{({{{{{.,,,||...||,,}}}}}}}.,,,,,|||}}}})),},,,,|{{{,...,{|||,,...(((....))).,||,,,,.}},,)))))))))))).......{(((((((((({..((((..{{,{({,{{{,..........(((.(((((({.(((((((((....)))))...))))}},..,}}))).))).((((((({,...,},))))))).,,,,}}}((((((........)))))),,{(({,.....,,..}}|||||{{,....,,,,)}}}.{((((((((((((((((((((,,..........,,.))))))))))))))..)))))}.})..))))...}))))))))))).....)))))))))))|(((((...)))))}..))).)))..)))))).)))..))))),))}.......,|{{{||||..{{,,......,})),}}..}))..}))))})))))))...(((((....)))))...,,.....

Transcripts

ID Sequence Length GC content
CUCCCGCGCCCUGCACCUCGGCAGGUCUCGCUCUCGGCACCCUCCCGGC… 7583 nt 0.3919
CUCCCGCGCCCUGCACCUCGGCAGGUCUCGCUCUCGGCACCCUCCCGGC… 7626 nt 0.3914
Summary

The protein encoded by this gene is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. The desmosomal family members are arranged in two clusters on chromosome 18, occupying less than 650 kb combined. Mutations in this gene are a cause of hypotrichosis and recurrent skin vesicles disorder. The protein can act as an autoantigen in pemphigus diseases, and it is also considered to be a biomarker for some cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]

Forensic Context

A study in humans using proteomics and RNA sequencing on serum from sepsis patients and healthy controls identified numerous differentially expressed proteins and genes, including the DSC3 [Wang et al. DOI:10.2147/IDR.S380137]. A study in human hearts and mouse models of arrhythmogenic cardiomyopathy demonstrated that the DSC3 is a desmosomal component with markedly reduced protein levels and junctional localization in affected hearts [Chen et al. DOI:10.1161/CIRCRESAHA.114.302810]. A separate bioinformatics analysis in human cardiomyopathy identified the DSC3 as a gene with mutations present before cardiac failure, though it was not experimentally studied in that work [Rahman et al. DOI:10.1038/s41598-024-78011-3].