Basic Information

Symbol
DSE
RNA class
mRNA
Alias
Dermatan Sulfate Epimerase DS-Epi1 DSEPI SART2 Squamous Cell Carcinoma Antigen Recognized By T-Cells 2 Chondroitin-Glucuronate 5-Epimerase Dermatan-Sulfate Epimerase DS Epimerase SART-2 Squamous Cell Carcinoma Antigen Recognized By T Cells 2 EC 5.1.3.19 EDSMC2 DSEP
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_013352.4
Sequence length
10621.0 nt
GC content
0.3969

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2991.50 kcal/mol
Thermodynamic ensemble
Free energy: -3203.21 kcal/mol
Frequency: 0.0000
Diversity: 2874.86
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((((((.((.(((.(((((.((((((..(.(..(((..(.(((((((...(((((((((((.....)))))..))))))..))))))).).)))..).)..))))))))..)))))).)).)).))..))))))))((((((.......(((.((((((((.(((((((((...)))))(((......)))..(((((((..((((((.((.((.(((((((((((((((((((.(((....))).))))))..................((...(((...((((.((((.((((.(((......(((.......)))..(((((((..((((((((..(((((........))))).(((((((.((((((..((((((((((....)))).(((((((..((((....)))).....)))))))(((((...)))))..))).)))....))))))....((((((......((((.....))))..))))))....((((....))))..(((...(((((((......(((((((.......(((((((((...............)))))))))..)))))))......)))))))...))))))))))..(((......)))))))))))))))))).....))).))))))))))))..)))..))..(((.(((((((......((((...(((.(.(((((((((.((......)).))))))(((..((((((....))))))..))).........((((((.(((...(((((((....)))))))((((.(((((((((((((....((((((((((....((((..((..((((..((((((.(....).))))))..(((((((....)).)))))(((((((....((((.((...((((.(((((.((..((.((.((((((((...(((((((......)))))))......(((....))))))))))).))((((((.....))))))........(((....)))..))..)).)))))...))))))))))..(((..(((((..(((((((((((((((((.((.........((.((((....)))).))..(((((.((((((((.........(((((((((.((..(((((.((((((....))))))...))))).)).)))))..))))(((((((.....((((((((.((.....(.((((....)))).)..))))).)))))...))))))).((.(..((((.(((........))).))))..).))....((((((((...))))).))).....)))))))).)))))............((.....))((((((((..((((((((....((.((......)).))...))))))))(((((((....)))).)))...((((((((.((((.((.((((((.(((((((((..(.(((....((((((((((((.(((.....((((((((....((((............((((((.((((((.((((....((((.((.(((((........))))))).))))....)))))))))).).)))))(((((((...(((....)))(((((.....)))))...)))))))))))...)))))))))))))).)))))))))(((((((((((((((..((((((((((((((((((..((((......))))))))))).....((((.............))))..(((((((.((.((....)).)))))))))..))).))))))))..((((((((((((((((........)).)))))))))....)))))((((((..(((((((.((((...(((((......)))))..))))......((((((((((((((.(((..((((((.((((..(..(((((((((.(((.....((((.((((((....(((..((((((((.((((..(((((((...((.((...(((((...((((((((((....((((((((.(.((.(.(((......((((((((((.....)).)))).))))...))).).)).)))))))))..(((((((.((....((..(.((((......)))).)..))....)))))))))...........)))))))))))))))..)).))....))))))).)))).)))))))).)))....)))).)).))))))).)).)))))))..)..)))).)))))).........((((((....((....)).....(((((((.(.((((.((((.........)))))))).).)))))))..))))))...)))))))(((((((......)))))))...(((.(((.((((((((.((((.(......).)))).)))))))).))))))..........(((((.....((((....))))..))))).))))))))))...((((.(((....)))...))))....)))))))..))..))))...((((.((.((..((((......))))....)).)).))))(((((((..(((((.(((.(((((...((....)).((......))..................((((..((((..(((.........)))..))))..)))))))))....))).)))))...)))))))...................)))))....))))))))))..........))).)..))))).....)))).)))))).)).)).))))))))))((((..(......)..)))).........(((((......))))))))))))).)).)))))))))).................(((((.((((((((((((.(((((..((((((((((((........))))..((((.((((((((((((.((((......))))))))....(((((....((((((((((.....))).((((....))))(((((.((((((((....(((((((((......))))))))).((.((((((((((......(((((....)))))..((.(((.(((...(((((((...)))))))....))).))))).........(((((((((((.((.(....(((((...((((((((..((((..........)))).))))))))...)))))..........).))...))))))))))))))))))))).)).........((((..........))))..(((((((((....(((((((.(((((((((.((((((.....)))))))))...)))))).(((..((((((((((......................))))))))))...)))..((((((((((.....(((((((((((((((.......))))))...((((...((((((((........))))))))...))))(((((...)))))...................(((((((...(((((((((((.(((.((((.((((((((((.((((((...((((..((((((....))))))((.(((((((((....))))..))))).))..........((((((((....))))))))..(((........)))...(((((.(((((...........((((((...((..((((.........))))..))...)))))).........)))))))))))))).)))))).))..)))))...)))..)))).))).))))))..))))).....(((((......))))).(((((......)))))))))))).))))))))).....))))))))))....(((((....)))))..((((((........)))))))))))))(((((((((((((....((((((((((((......(((((((....))))))).........((((((((....)))))))).((((....))))..............................))))))))))))........((((..((((((.....((((((....)))))))))))).))))..........((((((((((((.(((((((((....((((((((((((.(((((.......((((..((((.....((.(((((.(((((((...................))))))))))))))...))))..)))))))))...............((((((((((((............(((((.((((.............))))))))).((((((((((.....(((..((((((((((..............................((((((((.((((((((.............))))))))...))))))))....((((.((......)).))))......((((.................))))...((((..((((.((((((.(((.(((((.......)).)))))).))))))))))..))))...)))))))))).((((.((((((((......)))).....)))).))))....((((.(((........)))))))..)))....))))))))))..............))))))))).)))...........((((((.((((.....))))))))))..........(((.(((((....))))).))).......)))).)))))))).....((((.....))))...........)))))))))))))))))))))..)))))))))))))......((((((((.....((((((((((((((((..(((.((((((.((((((....(((.......((((((.....)))))).............)))...))))))))))))..(((((((((...((((.(((((..((.....(((((.((((((((((..((((..(((((...((((((((.....))))))))..)))))..)))).))))(((..((((((((.....)))))..)))..)))((((.(.(((((...))))).).))))...)))))))))))...((((.((((((.(((((..((...))..)))))...)))))).)))).((((((((...(((..((((..(((((((((((((.......(((.((...)).))).((((((....)))))).............(((((((((.....((((((......((((...((((((.((((((((.((..(((......((((((.(((((((((..((.....))..))))..((((......)))).....((((((((((((((....)))))).(((((....)))))..((.(((((((((.....(((((.........)))))....))).)))))).))...))))))))..(((((((((...)))))).)))..........((((((..(((.((((((.((.((((((((((.........((((((.......(((((.(((((((((((((.(((((.((((....((((((.((((((((((((((((((((...((((((((((((.((((((.((.(((((((.(.((((((((((((......((((((((((((((........(((((((((((((((..........))))))....)))))))))(((......)))((......))((((...(((((..((((((((((((((((...............)))))).....((((((((.(((..(((((...((((((((...)))))))).....))..)))..)))...)))))))).........((.((((.(((((.(..(((...........)))..).))))).)))).))....)))))))))).....)))))...))))..)))))))))))))).........((((.....))))..((((((....)))))).....))))))))))))).)))))..)).)).)))))).))))))))))))...)))))))))))))))).))))))))))....)))).))))).))))))))))))).))))).....(((((..(.(((((....))).)))..)))))....(((((((....))))))).........))))))...........)))...((((((..........))))))))))))).))..))))))....)).)..)))))).............)))))))))))...)))..))..)))))))).))))))..))))......)))))).........(((((((.....)))))))....(((((((.((((((((((.((((((.((((.......))))(((((((......(.((.(((((..(((((((.((((.((..((((.(((((((......................(((.((((((..((((..(((((...(((((.((((..(((((...)))))........)))))))))..))))).....)))))))))).))).....(((((........))))).))))))).))))..))....)))).)))))))))))).)).))))))))(((((......))))))))))))))))).)))))))))))((((((((((.(((.((.((.((((((...........))).))).)).))...)))..)))))))))).)))))))))........((((((((((((...))))..)))))))).((((((((..(((((((((.((((.....((((((((((......)))..(.((((((((...)))))))).)...........((((((((((((.(((((((.(((((........((((((((((........(((.((((((.......))))))))))))).))))))(((((((((..........)))).......)))))..))))).)))))))..)))).)))))))))))))))........((((((((((..(((.......................((((((((((((((((((((((.((((((((.((((....(((((((................)))))))....))))..(((((((........)))))))((((........)))).((((.......))))(((.(((((((.((((.(((((((((((.....))))))))).)).))))..........)))))))))))))))))))))((.((((((........))))))..)).......(((((((.....(((((((((((((((((((((((((((...............((((((((((((.........((((((..(((..(((..(((((((((((....))))))))......)))..)))..)))..)))))).))))))))))))......))))))))....(((((((.(((((((..((((........)))).)))).......))).))))))).)))))))).))))..........((((.(((((((.(((..((((....((....))......))))..))).)))))))..))))((((.(....).)))))))))))))))))).))))))))))))...))))))))))...))))))))))........)))).))))))....)))..))))))))((((....))))......)))))))))))))..))))..)))..))))))))(((....))).....((((....))))...))..))))).))))....)))))))))...............(((((...))))).))).))))))))))))))))))))))..)).)))))))))..(((((((.(((....(((.(((((((.....((((((((....((((((.(((((((((((...........))))))))))).)....(((....((........))...)))(((((((.(((((((.(.......).)))))))))))))).....(((....)))......)))))....)))))))).....)))))))))).....(((((((((...(((((....)))))..)))))....)))).)))))))))))))))))).))))))))))))...)))))......)))))))).))))..........))))))))..))))).....))))).)))))))..))))).)))))))..)))))..)))....)))))))....((....)))).))..))..)))))))))))))).(((.(((.....))).)))...(((((....((((((..(((((((..(((...((((((((((((((...(((..(((((((((.(((((((.(((((.(((((..(((.((((((((((.......((((((((((....((((((.(((((...(((((......(((((((((((...))))))((((((((....))))))))....))))).....)))))......))))).))))))...)).))))))))..((((((((.(((.(.((((((.((((((((.((.....)))))))))).......(((...)))(((((....)))))..((((((.((((((((((...............)))))))))).)))))).)))))).).))).))))))))(((.((((((...((((....))))(((((((((((((.......))))......((((..((.....)).))))...(((((((((..((((.(((((((.......)))).)))...)))).)))))))))))))))))).(((((((.........))).))))...)))))).)))..............((((((.....))))))((((((((((.....))))).)))))))))))))(((((((.....((((.((((((..((((........(((((.........))))).........)))).)))))).))))((((((.(((......)))...)))))).))))))).)).)))))))).))))).....((((((((..(((((((.(((((...((((......))))))))))))))))........))))))))......((((...))))..........((((((....))))))..((((..(((((..(((((.....)))))((((....)))))))))..))))...(((..((((((((((((((((((..(((((...)))))...)))))))))).......))))))))..)))..(.(((((((.....(((((((((.((..((((((((.(..(((....)))..).))))))))..)).(((.((((((((....)))))))).)))......(((((((.((((..(...(((((((((((.(((..(((((((((((..(((((((...((((((((......(((.(((((..(((...)))..)))))...)))...))))))))..))).))).)..)))))))))))(.((.(((((.........(((((((((((((((((((.......((((((.....))))))...))))))).....((((((.........))))))..))))))))))))...........))))).)).).....((((((((((((.((....)))))))..)))))))..............(((((....))))).....)))..)).))))))))).)..))))...)))))))((((((((((..(((((((((((((((((((....))))))).................(((.(((((.(((((....(((((((..(((((((...(((....))).....)))))))(((......)))...)))))))(((((((((....(((.....)))...))))))))).....)))))..))))).)))......(((.((((...(((((((((((.....))))))....)))))..)))).))).....)).))))).))))).)))))))))))))))))))......))))).)).)((((......))))((((..(((((......((((((.....)))))).....)))))..)))))))))))...((..(((((.((((......)))))))))..)))))))))))...)))...))).)))))))))))))))))))))....))))))(((((.........))))).))))))))))))).))))).)))).)).).))))))...))).).))).))))........))))))).)))))))))))).(((((.....))))))))))))).)))))).))))))))))).)))))..))).))).......))))))..............
Thermodynamic Ensemble Prediction
....((((((((((((.((.(((.((({{.((((((..(.,..(((..(.(((((((...(((((((((((.....))))),.})))))..))))))).).)))..,.)..))))))}}..)))))).)).)).))}.})))))))((((((.......(((.((((((((.(((((((({...}))))(((......)))..((((((({.((((((.{{.(,{(((((((((((((((.(((((((((((((,.(((((.....})))).........,(((({{{..{(((((.(((((...((((..((((..((((.(((((..(((((((..{((({{((((((((.......({{.(((((((((,(((((({{,..{,(((((.((((((((((.(((((...)))))....))))....))))))))))).|,.{{.(((((.((({,...,,.))),)))))}},|{{......((((.....)))).,(((((|.,..((((....}|||,,{......||||||...,.,}}||}}},)))))).,.,((((((((((..((.{((({||||{{..|((((..((((((((({.,,|||.....{{|{,{|{{{({(((((({((({.,|{((|,((({{{{{{{,.{(({((({((((({{{{,{{..,},},{||||(({((({({{((((({((({{{({{(,{{,,{{.,.....((((((((((((.{...,,((({.(((((((((((.,{{,,,,.(((((....))))).{((((((....))))))},..,.{(.{{{{|,|,.|,...,,},...,,}}|,|{,}},.,,..}}|...((((((.(....).))))))..{{(((||....,}.,))))..))))))))))).,.}|,.,({,,.......}}}||,.{{,...,||||...,))))))))))))))))).{|({.({{{{{{{{{.{,({,,,{.,|}((((((.....))))))....,,.}}||,,,.||,,,.......{(({(((,....}))))}}..,,..,,,,...,,,,,|||||||||||,}||,........{{.{((,....}))).}}.,{{(((,({{{{||||,{{.,,{{((({(((((.((..(((((.((({{{....})))))...))))).}),)))))..}))}{{|||||||....,,{||||,|{.....|}||||}},,)}})}),}}|||}|,},}}||,,}|}}||{{{,{||(({{,{{{{|,,,..|}||,,}},..}|}}.|,||||{{|{,,,,)))}).|||,....}))))}},,|||||{{{{,,,.,.,,|{{{{{{,{((((((((,.((((((((....({.((......)).})...))))))))(((((((....)))).)))...((((((((((({{.((.((((((.(((((((((..(,(((....((((((((((((.(((.....((((((((....((((............((((((.((((((.((((,...((({.{{.(((((........)))))}}.}))).}}.})}})))))).)})})))(((((((.,,({{....}}}(((((.....))))).,,)))))))))))...))))))))))))))))})))))))(((((((((((((((,{({(((((((,((((((({..((((......}})}}}}}}}}....,{{((,.....,,(,((({{(((((((({{,.{|}||,,}.}}.|}))}))),.,{|||||||,.....{|((((({{|||,,,({{{{{{{{|}{|||||||||.....,,,,.)))))...{((((.....))))|((((......))))).,.,,,}}))},}|,||})}}}})},,}},,..|||}},||})}}}}}|((((((((.(((,..,,{{{(.((((((,,..(((..((((((((.{(((..(((((((...((.((...(((((...((((((((((,...((((((((.(.((.({(({......(((((((({{,,...}}.}}}|.}}}},..))}.}.)}.}))))))))..((((({{.{{...|((,.{.{(((......)))}.,..}}..}.)}})))))).,,........)))))))))))))))..)).))....))))))).)))).)))))))).)))...,))))}}}.))))))).)).))))))),|}..||||,|||||,...,|}}}}}.|{{....|||{{..{{{...{{((((,,,.}}}))}.)))...}}).}}|}|)|)}|||}},}}}||}},}}}))}}}}}.....{{(((((,,,,..|}}}}||,..(((.(((.((((((((.((((.(......,.)))).)))))))).))))))....,.,{{{((((({{{.......,}})))...|{|||{|,,|,}||||,..{((({{((....)))....((((.{((((....}}).}}))))...((((.((.((.,((((......)})).,,.)).)).)))),{,{|||}}{{|||}|||..,,|,...||..,,})}}|.}|...)),,}},.............,((({{{{((..(((.........)))..))))}}))|||||.|{{{{,||.,||||...}))}})).,,,,,..,}}})}}}),,)))))....))))))))))..........))}.}..))}))..,,,)))).)))))).)).}}.)))))))))),,{{,...,.,......|||....|||{,(((((......)))))}}}}}}}}.,),)}}))}}})}.....,{{(((((....(((((.((((((((((((.(((((..((((((((((((........)))),.((((.((((((((((((.((((......)))))))),{{,(((((....((((((((((.....))).{(((....)))}(((((.((((((((.((.(((((((((..,,..||{{||||,.{(.((((((((((......(((((....)))))..((.{({.{((...(((((((...)))))))....)}}.})})).........(((((((((((.((.,..,.(((((...((((((((..{{{{..........}})).))))))))...)))))..........,.))...))))))))))))))))))))}.}}..,,,{{({((((.,,....,,.)))))}||||{{({({{,,{{{{{((,((((({(((.((((((.....))))))))).,,)})}}|{(({{{((((((,((,....},...}}))}}}}}}},.||||||||||,..|||,,{(((((((((.....(((((((({.,{{{,.......,,,,|(({...|)},.((((((((........))))))))...|{..(((({...})))).,}.............,,,{((((((.,.(((((((((((.(((.((((.((({((((((.((((({.{,(((({.((((((....)))))){,.(((((((((....})))..))))).||....,,|...((((((((....))))))))..,,|,,......|}}...{(((,,(((((.|,........{(({{{..{{{,.{{({.,...,,|.}}}},})),}.}))))),.}},,,,.})))))))))))))})))))).))..)))))...)))..)))).})).))))))..})))).....(((((......))))).(((((......)))))))))))).})))))))).....)))))))))),,.,|{{{|,..,|||||.,(({(((........}}}}}||||{{|.(((((((({{((|....|||||{|||||{....,.{{{{{{{...,))))))}.........((((((((....)))))))).{{{{....}}||,,..,.,,.,{,,,,,|,,,,.,,,|||,,}}}}}}}}}}}|{((.{,..{(({..((((((.....((((((....)))))))))))).)))),..,,,,...((((((((((((.(((((((((...,(((({{{{|||,.((((((.{{{{.......||||,,}}}}}}{{,{{{{{|||||,.,,..,,.......,,..)}}}}})))|}||{,.....{{(({.{((({{{.....,........{{((((((((((,,....,,.,..(((({.((((,............))))))))).,{((((((((..,..{({..{(((((((((....,,........................((((((((.(((((((({......)),...,}))))))...))))))))....((((.((......)).))))......{(((.,...{{....,}..,.)}}}.,.((((..((((.((((((.(((.((({{.......}}.)))))).))))))))))..))))...)))))))))}.((({.((((((((......)))).....)))).})))....(((,{(((........)))))))..)}}.},.)))))))})}..............)))))))))},}}...........((((((.((((.....)))))))))).,{,....,,|,,.{{{{{....)}}},})))}}}.}}})),,.,,)))}}|.{,.,(({{.,..,)))}}},||.....,))))))))))))))))))))}..}))))))}}}}}}.|||..{{((((((.....((((((((((((((((,,(({.{(({,,,{{{{{{.,,,(((,..,{,.((((((.....))))))...........,{|||...}}}))))))}||{{(..{{{{{.||||(({{(((((.......)))))|,......,{{{,..((((..(((((.,.((((((((.....)))))))),.)))))..)))).))))}|,..(((||(((.....}}}}),,|||,,,|{{{..,,,|||}},(((((((((((((((((((((..({.,{,...,},.},,,..)))))},...,})))))))))...,))))}},.,{{(((((((((...(((..((((..(((((((((((((.......(((.({...}}.}}}.((((((....}))))}.............(((((((((.....((((((....,.((((...((((((.((((((((.{(,.(((...,,.{(((((.{,{({{(({..{{,,,,.||.,||||..{{{{......}))}.....((((((((((((((....)))))}.{{(({....,)))}..((.(((((({{(..,..(((((......,..)}})),...}}}.)))))).)}...))))))))..(((((((((...)))))).))),{,,(.....|||}|{,.,{{{({((((,({.{{{{|||,,|}}},,,...{(((({......,(((((,(((((((((((((.(((((.((((....((((((.((((((((((((((((((((.,,((((((((((((.((((((.((.(((((((.(.((((((((((((......{(((((((((((({.,,.....(((((((((((((((..........)))))),...}))))))))(((...,..|||{{.....,})|{(({{,(((((.,(((((((((({(((((...,,,,.....,,.)))))}.....((((((((.(((..(((((...{(((((({...}))))))),.,,.)}..)))..)))...)))))))).......,.((.((((.{((({.,.,(((...........)))..}.})))}.)))).)}.,,.}))))))))).}...))))).},)))),.}))))))))))))}.......,{((,,...,,)},,..{{{{{{....,}))}}.....))))))))))))).)))))..)).)).)))))).)))))))))))),}.))))))))))))))))},)))))))))....)))).))))).))))))))))))).))))}.....(((((..{.({(((....))).)))..)))))....{(({{{{....}))))))...,.....))))))..,....}}.,}),},,|||||{....,,,...|||||||||}|||,}}..}}||||..,,,|,,.,|,,,,,}))....}))).}))))))))}}}...)))..))..)))))))).))))))..))))......)))))).........((((((({....)))))))....(((((({,((((((((((.((((((.((((.......))))(((((((......{.({.,((((..(((((((.((((.,{..((((.{((((((.....{{,.....,,.......(((.{(((((..((((.,(((((...((({{{((((..(((((...}))))..,.....)))))))))..)))))...,.)))))))))}.))).....{((((........))))}.))))))).))))..}}....)))).))))))),}))),)).})))))))(((((......))))))))))))))))).)))))))))))(((((((((({({{,{,.((.((((((..,,...,,..)))},)).)}.)),.,))}..,})))))))).)))))))))....,,,.((({{{{{|||,..,))))}.,}))))),.((((((((..(((((((((.((((.....{(((((((((......}}},.(.((((((((...)))))))).)...........{(((((((((((.(((((((.(((((........((((((((((,.......{{{.((((((|.....}))))))))))))),))))}},,,..((((..........))))..........,},.))))).)))))))..)))).))))))))}))))))......{.((((((((((..(((,,,,,..................((((((((((((((((((((((.((((((((,((((,,..(((((((................)))))))..,.}))}..(((((((........)))))))((((........)))).{{{{....,,.}}})|{{.(((((((.((((.({(((((((((.....))))))))).}}.)))).|,....,,.)))))))))))))))))))))({.((((((........))))))..)).......(((((((.....((((((({{((((({{((.((,(((((((.....((({{{({(((((,{{{,,{,,{,{{{{,{{{{{{..||{..{{{.,{{{((((((((....)))))))).....,,,,..})),,|}}..}}}}}}.}||},||||,,...}},},,,}}}},....,,{{{{(.{(({{({{.,((((((({{{,,|{|{{||{{{,....|||.,,,}}}}.)))}},,}.))))}}}},...,,||||.,,,||||}||,.}||||}}.}|},}},},.....}))))}})))}),,))))}}),))}},|}|}}..}.,,,,)))))))))))))).))))))))))))...))))))))))...))))))))))........)))).))))))....)))..)))))))){{{,...,))))......)))))))))))))..))))..)))..)))))))))))}}|,,,|||||||{{{...{||||,..,|..||||||}||},.,.}))))))}),.,,,.},})}.,,,{{((,...))))}.))).)))))))))))))))))))))),})),})))))}}},,,|||{{{{{{({{..(((.(((((((.....((((((((..,.((((((.(((((((((({.{........,))))))))))).)....{{{....{{........))...)))(((((({,((((((({,.......),}})))))))))))).....(((....)))......))))),|,.}))))))).....)))))))))).}}),))}.,{{{{,..(((({....}))))..)})}}.,,..))).)))))).)).)))))))).))))))))))))...)))))}}}...}))))))).)))).,....,,,.})))))))..))))).....))))).)))))))..)))))...,}})))))),|||||||{||||},||,|....,|..,,}},|}},|}||}|||,,...|,}|,|},||},,,,...},),)})))},}))),.}}}}))}))}}))}},||}}}})}}..|||||||||}|((((((.....)))))),|..{{.{{({((((((.(((((({....,(...{{,{(,{((({({{,,.,,.,...,)}},||},|||||....,.....})))))}.))))))},,)).}),(((((((((....))))))))).............|||||{{{,{{}}|||,||.{(((((((.(((((((...,.........))))))).)).)))))}.((((((....)))))){|||.,....|||||.||||(((((....)))))..(((({{.{((((((({{..,,||....,}.,,)))))))))).}))))}.)))}}}}}),.}})))))}{((({.,,}|{{{{.((((....)))),}}))).,.||{|}}},...}|||...,.,||||,.,,..,,,})})))).))}|||||||,..((((.(((((((.......)))).)))...)))).|,||||||||...}}}}}}}},|{({,,..,{{..|,..}},|{|,,,)))..}}}},}}},},)))},.((((((.....))))))((((((((((.....))))),}))))))))))))),.(((((((,,......,,.))})})))...,,.,,,,..,..,}}})))}...,))))))..)))).}..)))))))))))..))))))))))}}}....,.))))))))),)))))).)))))))))}))))).))..)))))})))(((((((.(((((...((((......)))))))))))))))).........,,...........,,....((((((({,((((..((((((....))))))..((((..((((((((((((.....)))}}}}|,....,,,})))))..))))...(((..((((((((((((((((((.,(((({...})))).}.)))))))))).......))))))))..))).,({,{(((((.....((((((((((..({((((((((,{..,{,....,}),.),}))))))|,,.((((((((((((,,.,,{{{{{{{{{........{{((((.{{{{{,((((((((({{(({(((,,,,,..(((((((((((.,{((((({,{,((((((((......{.(.(((((..(({...}))..))))),,.,,....)))))))).,))},))}.)},))))))))))),.,,,|||,{,},},....(((((((((((((((((((...,.,.((((((.....)))))}...))))))}.....{{{{({....,....})))))..}))))))))))).{{{{{{{{{{||,,,.{{{,...,,(((((((((({{{((....))))))),.}))))))........}}}}}}||,||}}}}),,,}.,,||))|,{|{{{{..{|||{{{{{({{((,,,{{{{{{{,,,,{||.,.}}}}},,||||,.(((((((....))))))).,|||.,|,,,,.....,|,}}},,,,}.,,,....(((((({.,{({{{{{...{{{..,.}}},....})))})}{||,.....||},..})))))))))))})))))))).,))))}||,...,,.,}}},},,.,..)))))))))}}|}.,.}}}}}},.}||||}}}}{((,((((((.....}))))).,}}},,},..,,)).,,))))))))))))..,,,,,,,,))).....)))))))))){{.{{{||,,,.))})|,||..}}}}),})}|....(((((...,..((((((.....)))))).....)))))..,,.))))))))))))...(((({,((((......))))))))).))))..)))})....)))))))))))))})))),))))))))))))..((((....(((((.{,....,,))))))))){{{,((.......,)}}|||,.......|,((((({........}.))))).||{{.....}})}..))))))))))).(((((.....))))))))))),}.)))))).))))))))))).)))))..))).))).......))))))..............

Transcripts

ID Sequence Length GC content
AGUAGCGUCGCCCGAGGCUGCAGCAGCGCAUCCCGGGGCAUGGCGCGGC… 10621 nt 0.3969
Showing 11 to 11 of 11 entries
Summary

The protein encoded by this gene is a tumor-rejection antigen. It is localized to the endoplasmic reticulum and functions to convert D-glucuronic acid to L-iduronic acid during the biosynthesis of dermatan sulfate. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. Mutations in this gene cause inmusculocontractural Ehlers-Danlos syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 9, and a paralogous gene exists on chromosome 18. [provided by RefSeq, Apr 2016]

Forensic Context

A study in mice demonstrated that the DSE was selected from a microarray analysis of heart tissue following methamphetamine administration and restraint, but quantitative RT-PCR validation did not show a statistically significant change in its mRNA expression [Shinone et al. DOI:10.1016/J.Legalmed.2010.01.001].