Basic Information

Symbol
DST
RNA class
mRNA
Alias
Dystonin BP240 BPA KIAA0728 CATX-15 MACF2 BPAG1 Hemidesmosomal Plaque Protein Bullous Pemphigoid Antigen 1 Dystonia Musculorum Protein Bullous Pemphigoid Antigen FLJ21489 FLJ13425 FLJ32235 FLJ30627 DMH DT Bullous Pemphigoid Antigen 1, 230/240kDa 230/240 KDa Bullous Pemphigoid Antigen 230 KDa Bullous Pemphigoid Antigen Trabeculin-Beta D6S1101 CATX15 EBSB2 HSAN6 BP230 EBS3
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_001374736.1
Sequence length
24709.0 nt
GC content
0.4164

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-6659.40 kcal/mol
Thermodynamic ensemble
Free energy: -7117.88 kcal/mol
Frequency: 9.88131e-324
Diversity: 5992.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.((((((.(........).)))).)).))(((((..((((.((((((.(((..((.....(((((...)))))))))))))))).)))).)))))..(((.((((..(((((.(((.((((.((((((..((((((((((...))))....((((.(((((...))))).))))..)))))).))))))))))))).)))))...)))).)))(.((((.((....)).)))))(((.(((.(..((.(.(.(((((((((((((((((((........))))...........((.(.(((((.(((((((((((....((((..((((((..((((((((((((((((((.(((..(((((.(((......((((((...(((((...))))).))))))..(((.(((((((.((((((..(((((((((((.((.(................).)))))))))).))).)))))).)))).))))))))))))).)..)))))))).........))))))))(((((((((((((((....)))))))((((((((..((((..((...((..(((..((.....((.....)).....))..))).)).))..)))).)))))))).....)).))))))......((((..(((((((((...(((......)))........(((.(((((..((((....))))..))))).)))...((((((....))))))..(..((((.......))))..).......))))))))).))))......(((((((((((..(((...((((.(((......((((((....(((((.....)))))((((......))))..(((((........)))))........(((((...))))).......))))))))).))))..))).......((((..(.((((((.(((....))))))))).).)))).))))))))))).....((((((..((((((((((..((((((....).))))))))))))))))))))))))))))))))))))..))))))))..............))).))))).).))))))))))))....)))))).).))..).))))))..(((((((..((((.....((.((((.....)))).)).....))))..)))))))(((((((........(((((((((((((((......((((((((((((((((((.....))))))))).((((((((((.....)))....))))))).((((((.((((......))))..))))))......(.((((...((((((....)).))))....)))))((((..((((((.(((((((((((...((((((((...)))))..((....))...(((((..............)))))(((((((..((((((.....)))).))..))))))).(((((((.((..((((((..(((.........)))..))))))..)))))))))........(((((((....((((((((((...((((..(((..(.(((((((..(((((.....)))))...........(((((((......)))))))..........((((((...((((((..((((((((..(((.(((.((((..((((...(((((.((.(((((.....))))).......)))))))...)))).)))).))).)).)..))))))))((((.....)))).........((((((((((((.............))))).))))))).................))))))..))).))).....................(((((.((((((......)))))).)))))....(((.((.....)))))(((...(((((.......)))))...)))....((((((.....))))))...((...))..))).)))).).))).)))))))))))))).....((((((...((((((((....))).)))))(((.((((((((...(((...((((((........(((.(((...((((((.(((.(((....((((((((((....))))))))))))).))).))))))...))).)))(((((.((((((.((.((((....((((...(((.((((((.((..(((((((..(((((.((((....(((.(((.........)))..)))...)))).)))))...)))))))...)))))))).((.((((((((.....(((((....)))))(((((((.(((.............))))).))))).........)).)))))).)))))..))))...)))).)).))))))))))).))))))...))).)))...))))).)))....)))))).......))))))).......)))..)))))))))))))))))))))((((...((((.....))))...)))))))))))))(((((((((((((((((.(((((((((....(((.....))).((((((.((((((((((.(((((..(((((.(((.((((....))))..((((..((....(((((.(((.((((((((((((..(((((....)))))...))))))))........((((.....))))....)))).)))..)))))...))..))))(((........)))))).)))))..))))).(((((.(.(((((........))))).).)))))..............((((...(((....((((((.....((((((..((........))..))))))))))))..)))...))))...((((((((.(((((.....))))).........)))))))).......))))))))))..........((((((........))))))...((((....((((.(...((((.(((((((.........))))))).))))...).))))))))))))))(((.(((..(((.((.......)).))).))))))..(((((((((((((....(((((.((((((......(((......)))........)))))).)))))(((((((.((((......))))))))).))......(((((((((((.....)))).))).........((((((((((((((.(((((((((.......))))))..((..((((((......))))))..))....))).)))).....((((...((((((((((...((..(((((((.(((((((((.....(((((((.(((.....((((((((..((((((((...............)))).)))).......(((.((((........)))).)))........)))))))).........(((((...((...((....)).....))............(((((((...((.(((((((((((((((...(((((............(((((.((((.(((((....))))).............(((((((.....(((((((..((..(((...)))..))..)))))))..)))))))....(((((..(((....)))))))))))).)))))...(((((..(((((((((((.((...........)).)))))))))....))..))))).)))))..))))..))))))).))))(((((........)))))(((........)))...((((.(((((..(((....(((.((((((...)))))))))(((.((((((......)))))).)))((((((.......((((((.............(((((...(((((.(((.......))).)))))...)))))....))))))........))))))....)))..))))).))))..((((((..(((((((..((((.(.((((((((((.((((((((((((((((.((((.(((((((((((((....(.(((((.(((((..((((((.....((((((((.((....)).)))))))).))))))((((((((((..(((((....(((.((...(((((((((((....((..(((..(((((....))))).)))...))......))))..........................((((((.....)))))).....(((((......)))))))))))).)).)))......))))))))))).))))(((((((.(((((((((.((...(((((((((((..(..((((((((..((..((((...(((((.((((..........((((((..((((((..(((((((((....))))).))))(((((...((((((.(((..(((.......(((((((((...........)))))).)))((....)).....(((((......)))))....((((((.(((.((((((((((.................))))).)))))))).))))))((((.(((..((....))..))))))).(((((....((((......(((((..(((((..((((((((((((((((..............))).))))..))))..))))).......))))).))))).....))))....))))))))..)))))))))............(((........))).(((((((.(((((.(((..((..((((((((((((((((...((((............((((((........))))))..))))..))))...........((((...))))......)))))).)))))).))..))).))............)))..))))))).......)))))))))))..))))))..)))).)))))...)))).))..........((((((.....)))))).(((((..............)))))........(((((..(((.((....)).)))..)))))..).)))))))..)..)))))))..))))...)).))))))..((((.((((((((..........))).))(((((((.(((....(((((........(((((..((((((((................((((((......(((((((((..((....(((((((((.....((((.......))))..)))))((((((((..((....))..)))))))).........((((((.....)))))).........((((..................))))...))))...)).)))))))))..))))))........(((((...((((((..........(((......)))........)))))).....))))).........)))))))).)))))....))))).)))))))))).....))).)))).)))..))))).)).........))))).))))).)..)).((((((......))).))).....)))))....))))))..)))).))))))(((((....(((((..(((.(((((((((....(((........)))...))))))))))))((((((.....)))))).....((((((((....))))).)))....))))).)))))...(((((..((.(((((((((..(((..........)))...))..((.(((.....))).))(((((...(((..........)))...)))))((..(((...)))..))..)))))))...))..))))))))))))))))))))))))).)))))))).)))).....)))))).....))....)))))))..........(.(((((((...((((((.......................))))))))))))).)...(((((((........(((.(.((((((....((((((...((((((((((((((....(((((......))))).((((((((..((((....))))..))...))))))(((((...((((((((((..............((((.......))))..((((((....(((((((((((..(((((...))))).......))))....)))))))))))))...))))))))))...))))).............(((......)))....)))))))))))))).)))))).)))))).).)))..((((.((((....)))).)))))))))))..((((...(((((((....)).)))))..))))((((....((((((....))))))..))))(((((((((((....(((..(((((..(((((..(((((((((((((((...((((((..((((.(((...((((.(((.......))).))))...))).))))......)))))).((...((((.(((...))).)))).)).............(((((((((....((((.(((((....((..((((.(..(((((((..((((........((((((((......(((.(..................))))((((.(((((((((((((..(.((((.((......((.((..((((.(((.........))).))))..)).))......(((((((((((.............((((((((((((((((((........(((((.(((((.......(((((((...(((((.....(((.(((.(((((...(((......(((((((((...((((((....))))))((((.(((..(((((...(((((((((....)))))).........(((..((((((((((((..(((((((((((((..((((((..(.((........)).)...))))))..........(((((...(((((...(((((((((.(((((.......))))).)))))).)))...)))))..((((.(((.....(((..((((..((.....))..))))))).....))).))))...)))))((((((....(((((((..(((((.(((((((.((((...........)))).)).))))).)))))..)))))))...)))))).(((((..((.(.....(((....))).....).))..)))))...)))))).)))))))..))))))))).)))..)))........)))...)))))..))))))).....)))))))))((.(((...((((.........))))....))).)).....((((((....((((.((......(((((....))))).....)).))))....))))))..(((((((((((......))))))...)))))......)))...))))).))).)))......((((((((..........(((((((((.(((.(((((((((((((.(((((...((((..((((........((((........)))))))))))).))))).....((((((((((((...(((........)))......)))))..((....))..)))))))...((((((.......)))))))))))))).))))).))).............(((.((((((((((((((((((((..(((((((((((.((((.((((((((((((((((((.........))))))).)).(((((((.............((((.......))))..............)))))))...........(((..(((((((((....).))))))))..))).((..(.(((........))).)..)))))))))))..))))....))))).)))))).........((((((.((.((((((..........((((((((....)))))).)).((((((........))))))(((((....))))).......)))))))).)))))))))))))..)).))))))))).)).))).)))))))))...(((.....))).))))))))(((((((.(((((.((.(((((....(((........)))..)))))))))))))))))))..........)))))))))))).(((..((((((((((....((((....)))).........((.(((....)))))(((((((....))).))))....)))))))))).)))))))).)))))..(((.(((....))).)))........(((.((((.(((((((((.......((((((...((((((......))).))))))))).....))))))))).)))).)))..(((((.((......)).)))))..((..(((((.......)))))..)))))))))).))))).))))))))))))))))(((((((((((........))))).))))))(((((((((.((((.........(((.....))).........)))).)))))..))))(((((((((.((((......((.(((((..(((((((((...............((.((.((((..((....))..)))).)).))..(((((.((...(..(.(((...(((((.((...((((..(((.((((((......((((((((.....(((....)))..(((((((((.........(((...((((((....(((((..................(((((((........((((....))))(((((((.(........))))))))...((((((...((((.((((...((((((...........)))))).........((((((((.........(((((((((.((......(((.......((((((((..(((.((((((((((((..(((((((.(((((((.........(((.......)))............))).(((...((((((((.((((((((.....(((((((((((((((((..((((((....))))))..........(((((.(((((((.(((((((((..(((((((((((....))))))).....((((.((((((.....((((((..((((...(((...)))..)))).)))))).....)))))).))))....((((((...((((....)))).((((((......(((((((...((((...))))...)))))))..)))))).((((((((((((.(((((..........))))).))...(.((((....((((..((..(((((((((..((.........((((.(((((((((.((.((((((((......(((......))).....)))))))).))...))))))))))))).......))..))).))))))..)).))))...)))).))))))))))).........................)))))).((((...))))......)))))))..))))))..((((..........)))).........(((((((........(((...((((((.((((((...((((((..((...))..))))))....))))))((((((...))))))))))))...))).((((((..((((((.(.((....(((((((((((((.(((.((.((((.........(((((((((((...........(((((.((((...........))))...)))))..............(((((((((((((.(.((((((.....((((((((((...((.......(((((.((((........))))....(((((.((((................))))...)))))....(((.((((.........))))..))).))))).......))...))))).))..)))......((((((((..((.(((.((((((((((......)))))))))).))).))......((((((((((((......))).)))))))))((((((...(((((.....(((((((........))).))))...))))).......)))))).(((.((((((...........)))))).))).))))))))..............)))))).).))))((((((.((((((.......)).))))(((((.(((((......))))).))))))))))).......)))))))))...)))))))))))..((.((((....).))).))...(((((((((...)))))))))(((....))).....((((((((........))))))))...(((((((......).))))))....(((((.....)))))))).).)).)))..)))))))))))))))).)))))))))))))))))))..(((((.((.(((......((((.(((........))).))))......))).)))))))(((((.............)))))..))))))).))))).........)))))))...)))))))))).....))))..)))).))))))))....)))........)))).))))))).)))))))....((((((((.((((....))))......((((((((((........(((((.....(((((((((((...((......))....)))))))))))..)))))..............((((((...((((((.(((............((.((....)).)).((((.(((((((..............)))))))...))))...((((((((((.(((((((.((((((..(((..((((...))))....)))..))))))((((((.(((((((((.....(..((...))..).....)))))))))..)))))).................(((((((((((((((((..(((((...((((((((((.((((((....))))))....((((((..((((....................(((((....)))))........(((((((((((............(((.(((((((((..((((......))))...)))))))))))).((((((.....))))))..((.(((((((.(((((((((..(((((((..((((((((((((((((.((....((((....(((((((..((((..........(((((.(.((((((((..((((......(((.((((....))))))).((((((((((..(((((((.(((........)))..((((.((.(((((((((((((..(((((...................((((.(((((((....(((((((((.((((.....(.(((((.(((...(((....)))....))).))))).).........(((((((((((((.....((((((........((((.....))))))))))(((((((((.....(((.....(((((((((.........)))).))))))))....)))))).......)))..((..(((((((.(((((....(((((.((.........((((.((((((...(((((..(((((((....)))).....)))..)))))...)))))).))))...((((.....))))....)))))))..))))).)))))))..)).....))))))))))))))))).)))..))))))))))))).)))).....(((.....))).....))))).)))))))...)))))).))..))))..(((((((.......(.((((((((.(((......((((......((((......)))).(((((((.((((((((.(((.....))).......(((((....)))))((((((..((((..((((((..(((..((((((.(((((........))))))))))).((((....(((.....((((.......))))...)))))))...((((.((((((((..(((((....)))))..(((..(..(..(((.....)))..)..)..)))....(((.......)))....((((((.........)))))).(((((((((...((((((((((..((((.(..((((...(((........(((((((.((((.....(((....(((.(((((((...(.((((.....)))).)..))))))).).)).....)))..)))).))))))).....(((((((((.(((...((......((.....)).....))...))).)))))))))...)))...)))).....((((........)))).((.....))((((.((...((((((..((((((......(((..(((((((((..(((((((((((((.(((((.(((....(((.((((.((........(((.......(..((((((.........))))))..)....)))..........)).))))..)))....))).)))))))).............))))))))))....(((((((..(..((((((.....))))))..)..)))))))...(((((....)))))..........(((((((((....)))))..))))............)))))))))..)))..((((((((((....))))...))))))..((.(((((((((....))))).)))))).(((((........))))).(((((((((((.(((((((....)))).))).)))(((......)))((((....))))(((((......))))).......))))))))..((((((.((...)).))))))....((((...)))).(((((......))))).(((.((((((...)))))))))...(((((((((..((((.(((((...)))))(((((((.(....(((((((((..(((..(((((.((.((.......(((((.((.....)).)))))......)))))))))))).))))))...))).....).)))))))......(((..((.......))..)))((........))(((((((((((((..((...((((.((((.((((.((......)).)))).)))).))))..))..))))))))((((((((((..(((.((((((............................))))))(((((((.((.((((((((((.((((.((((.((..((((((((...(((.....(((((.....)))))(((((.....))))).......(((((((((..(.(((..((((.((...((((...))))...))..))))......))).).)))))))))......((((((((..............)))))))).....)))..))))))))))))))..))).).)))))).........(((((((((((((((((((((..(((..............((((...)))).(((...))).((((((.........(((...))).(((((((...)))))))..)))))).((((..(((((.((((.....((.(((.(((((....))))..).)))..)).....)))).))))).))))(((((((.((.(((.......((((((....))))))..(((((....))))).((((((((((.(((.((((((((((........(((((((((.((((((......)).))))((((((((...(((((...)))))........)))))))).((((......))))...........((((((......))))))..(((((((..(((((.....))))))))))))...........))))))))).......................(((((((((....((((((((((...)))))))...)))..(((((((((....((((................))))..(((....))).))))))))).............)))))))))..(((((((...........((((((((..(((((.((((....((....)).))))........))))).))))))))..))))))).......(((.((((...........)))))))................(((........)))(((((((......)))))))((((.((...)).)))))))))..))))))))...)).))))))))...((((....(((((.....((.....))...)).)))....))))...((.((((((.(((.((.....)))))...)))))).))........((((....)))).))).)).))))))).))).))))))))......)))))).)))))))((((.((......)).))))....((((.......))))((.(((((..(((((......(((..((((((((((....((((.......((((..(.(((..(((((.....((((......))))..)))))..)))...)..))))(((((((...)))))))............)))).....)))))))))).)))....(((((...)))))....(((((((..(((.((.(((((...((........))...))))).)))))))))))).)))))..))))))).....................((((((((.......))))))))....)))))))))))))...............((((((....))))))((((((((.((((.(((((((.((((((((...))))))))..(((.((((((....(((((.((((.(((((..((((....))))))))).......(((((((.(((.((....)).))).))))).))..))))))))).......)))))).)))..))))))).)))))))...)))))....)))..)))))))))).....((((.((((......))))))))......))))).((((...........((((....))))...........))))))))...))))))))).....))))))...))))))...)))))).).))))..))))))))))(((.((.(((.......)))..)).))).........)))))))))..(((((((((((....))))).))))))....................)))))))).))))..)))..))))))..)))).)))))))))))))).))))))).(((((((....((((..((............))..)))).....)))))))........)))).....)))..)).)))))).).....(((((((.((.....)))))))))....)))))))...(((..(......)..))).......)))))))...))))...))))))............))))...)))))))).).))).))))))..))))))).)))).....))..))))))...........(((..((..............))..)))....)))))))))).....((.(((.......))).))....)))))))...((((..((......))...))))........(.(((.(((......))).))).).((((.....))))))))))))).))))))).))...(((((.(((((.........(((((....)))))..........((((((.((....(((.....))))).)))))))))))))))).......(((((((((.(((.(((.......(((((.........)))))......))))))))))))))).(((..(((...)))..)))(((.......))).(((((((...)))))))..)))))))))))...))))...)))))).))))))))))....)))))))).).......)))))))))))))..(((((....(((((((.......(((...(((((......)))))....)))....(((((((.(((..(((((.(((..(((((((....((((((..((..((((((((((((.(.(((((.((.....))...))))).)))))))))))))(((...)))..(((....))).(((....)))....(((.((((..(((((((....)))).)))..))))..)))....(((((((.(((((((.......(((((.(((..(((((.((.(((((((((........)).))))))))).)))))..))).)))))...))))))).....((((((.........(((............)))(((((.......)))))(((.....)))..)))))).))))))).......))))))))......)))))))...........))))))))((((.(((....))).)))).))).)))))))...(((.....))).....)))))))...((.(((((((((.(((..(((((((.((((((..(......)..))))(((((.((((.((......)).)))).))))))).)))))))..(((.(((...(((((((..((((......((((((((........))))).)))............))))..)))))))..))).)))....................(((((..........))))).......((((..((((....))))...))))((((((......))))))....)))..))))))).)).)).))))).)))))))...))))))))))......))).)))))).))))))))))))))))...))))))))..((((((....((((..((((..(((((((....))))))))))).(((((((((.((((.((...((((...(((...)))...))))...)).)))))))))))))....))))...))))))...................((((((.....(((((.(((.(((....(((...)))...))).))).)))))...)))))).....((((.....))))((((.......((((((....)))))).....)))).))))).))).))))))))...((((...))))......)))......)).)))).))))))))))))).....)))).)))))))))).........(((((((((((((((.....))))).................((((((.(((..(((((............((((((........)))).)).........))))))))..))))))....((((....))))..((((((......(((((((((.....((.((((((..(((..((((((........((((.(((((((.........(((.((.((((.......)))).(((((((((...))).))))))........(((((((..((((((((((...........))))))........))))..)))))))(((((...(((((........(((.(((((.....(((((((((.......(((((((((((((((((.(.(.....).).))))).))))).(((((.((((((.(((...((((((((((........(((((...(((((.......(((((..(((..((((((....(((((((((((((..(((.....(((...)))..)))))))))))...(((((......))))).)))))))))))..)))......)))))......)))))....)))))..(((......)))....((((((((((.(((..((((.((((..((((...((((.(((((((.((((((((((..((((.(((((((((....))))))))).......((((.((((....((.......((.......))..........))...)))))))).((((((.(...((((......(((((.(((((((............((((..(((((((((.(((..((((((((((....(((...((.(((.((.(((....((((((.((((((...(((......((((...((((..((((((((((((.....))))..(((....(((((((.((..((((.......))))..))....((((.....))))((((((((((((....(((...))).....((((((((((((((..((((...((((((((((((.((.......))))))))........(((((((....((((...))))..)))))))..((((((.((((...)))).))))))..(((((((.......(((((((((...(.((((.............................)))).)...)))..........))))))........)))))))..........(((.(((((((((((...(((......))).((((...((((((((.....(((((.(((..((..(((...((((((.(((..............))).))))))....)))..))..)))..))))).(((((....((((..((..((......)).))..))))..)))))....(((.......))).((((.........))))....(((((.....)))))..((((((((((...(((((((((((((...(((((.(.......(((.(((((((.............((........)).............)).))))).))))))))))))))).))))))).....))))))))))..........((((((.((..((((((((((....((((((((((..((((.(((((((((.((((..(((((((....((((((..((((........))))..(((((.(((((.((((((((.((((.(((..(((((((((((((((.(((((.((((.....)))).((((((((.......(((...((((((.((.((.....(((....))).....)))).))))))...)))((..(((((((.....)))))))..)).......(((((((((((......((....))...))))))).)))).(((((((((((((...((((((.(((.(((.(((((((....(((((.((((((...............((((((((((.((...)).)))))))..)))((((((.(((((.........((........)).....((((..(........)..))))))))).))))))(((((((.......(((((......((((.((((.((..((((.(((((............)))))))))..)).)))).))))...))))))))))))(((((..(((.........((((((...((.(((.((((((...(((((((((((.((.((((((((((((.......))))))(((((..((((((((((......))))))))))..)))))....)))))))).)))))))..............))))...))))))((..(((((((((..((....))..))).))))))..))(((((.......)))))...........)))..)).))))))...((((((......))))))....(((.((.(((.....))).)).))).)))))))))))))))))))....))))))).)))...(((((((((((...((((..(((..........)))...)))))))).....((((((((((((.....((((((..(((.....))).)))))))))))).....))))))(((((((...(.(((((....))))).)(((....)))....((((((..(((((....((...(((((((..........)))))))....))...)))))...))))))..............(((.....(((((.....).))))..))).........)))))))..))))))).....(((((..(((.......))).)))))....(((((((.......))))))).((..(((.((.((((.(.(((.((((((((((((((....))..)).)))))....))))))))).)))).)).)))..)).)))))))))....))))))))).)))).....((((........)))).....(((((((((.(((((....((((..((.((((.(.((((((((((...((...(((...............)))...))..))))).))))).).)))).)).(((.((((...(((...(((..........................)))...)))....)))).)))(((....)))............((.....))....))))..))))))))..))))))..(((....)))...)))))))).....))))))))).))))......((((....)).))......))))))).....))).))))...))..)))))).)))))))))).((((.((((.((...)).)))).))))........(((((((((((.((((((((((((.((.((......((((((........((((((((.((.....)))))))))))))))).)).))..)))).)))))..))).))....))))))))).......)))))).....)))))))))))....((((((.......))))))(((((((....((((((...(((((((((......((((((..(((.(.((.((((((.(((.....))).))))))...(((((..((......))))))).................)).))))..))))))((((..........))))....)))))).)))((((...)))).........))))))...)))))))...((((.....)))).))))))(((.((.((.......)).)).))).(((((....)))))..(((.((((....)))).)))........(((......)))....((((.(.(((....))).).)))))))))))..))))).)))))....))))))))))..))))))))...)))))))))))))))))).)))))..))))))))).)))))))))))))))))).(((((..(((.....))).)))))...((((((......(((((.(((..(((......(((.((....)).))).....)))..)))...)))))...))))))..)))))))))))).(((((.(((........))).))))).....((((((((.((....))))))))))..((((((.(((...........)))))))))..((.((((.((((.(((....((((((...((.(((....)))))..))))))..))).)))).)))).)).....))))))))))))))))))(((((((((((((((((.....)))..(((((((..(((((.(((.((((((((((.(((...((........))...(((...........)))...((..((((......))))..))((((((((((((((((((.(((((((..(((((..((.((((((.......))))))))..(.((((...((((....))))...)))).)...((((((((((.(((((((((.((((((((.(((.....)))..(((((...(((((((((((((.(((((((.(((((...((((((....((..((((....))))..)).....(((((((.(((((((.((.....((((...(((.....)))....)))).)).)))).))).)))..)))).......))))))............))))).))).))......)).))))))((.....((((((..((....((((.(((.(((....)))))).)))).))..)))))).....))..))))))).....)))))...(((((((.((.(((((.....(((...(((....((((((..........)))).)).....)))...))))))))..(((.(((((((........(((....)))..)))))))..)))..))))))))))))).)))).))))))))))))))...)))))((((..((((.........))))..))))..(((((..((....))..)))))((.(((..((((.....))))..))).))..))))).......((.(.((((((.....((((.((((....))))))))....(((.((((((((((((....)))))((((((((...(((((((...))))))).(((((....)))))........(((((((((........(((((..........(((((.((...(((((.....((((......(((........))).....))))))))).)).)))))(((.(((..(((........)))..))).)))))))).......)))))))))....(((((..((......))...))))))))))))))))))))..))))))))).).))...))))))).....))))).))))).)))))))).))).)))))))))).))).....)))))..)).))))))))))))).)))))).......))))..))))..)))...)))))).))))))...)))))))).))...))).....................((((.(((((......))))))))))))))))))))))((((.(((.......))))))).(((((((.......))))).))....)))))))))))))...(((((......)))))))))))).)))))..(((((.(((((......)))))))))).................)))).).))))))..........(((((....)))))(((((((..........)))))))...))))..)))..))).)))).))).))))..)))).......(((((((((.(((........((((....))))...((((..(((....)))..)))).))))))).))))).))))..)))).)))).....)))))))))).)))))))))))))..))).)))))).)))))......((.(((((((((......)))).))))).))....((((((......)))))).(((.....))).....))).))))....)).))))))).....))))).)))..(((..(.((((((...((((.....))))..............(((((......)))))...)))))).)..))))))))....)))))..)).)))(((((.....(.(((((......))).)).))))))...........((..(((((...))))).))))))))).))))........)))))).)))..)))))).))...))))))))).....))))))........(((((((((((...((((...((.....))...))))....))))))))))).....((((((.((((......))))))))))))))))))))....((((((...))))))))))))).((((((...))))))..)))))...))))))..)))...)))))))))......)))))))).))))))...)))...))))..)).)))))....))).)..).)).)))))(((((((....))))))).))))))))).)))))))(((((....)))))....)))).))))))))).)).)))))..))))))))))))))))).....(((...(((.....)))...))).((((((.................)))))))))))))))))).)))))))..).))))..))......((....))..(((((.(((...))))))))...))))))))).))))))))))))))))..).)))))))))))).)))))..))).....)))))))))))...............)))))..(((((....))))))))..)))))))))))))))).)))))))..)))))))))))))))).((((((.(((.(((..(((((....))))).))).))).))))))............)))))))))).))))..)))))))))))))...))).))))))))))))........))))..........)))))))..(((((...(((((....)))))...)))))(((((......))))).))))).))))))))))((((((.((((((....((((((............))))))((((((....)))))).)))))).))))))..(((((............))))))))))))..
Thermodynamic Ensemble Prediction
((,(((((({,.....}}})}},}|,||,||{((((..((((.((((((.(((..{{.....{((((...}))))}}))))))))).)))).))))}..(((,((({,.(((((.(((.((({{((((((..(((((((,((,{{||}.....||||.(((((...))))).)})).))))))).))))))))))))).))))).,.)))).)))|.{({{,|{,.,,})}}}}}}(((,{{{.,..{{,{.|,||{{{((((((((((((((,,...,,.))))|..........((.(.(((((,(((((((((((.,..((((..((((((,,(((({(((((((((((((.(((..(((,{{(((......((((((...(((((...))))).))))))..(((.(((((((.((((((..(((((((((({,((.(...{,....,,..,}.),)))))))))),,)).)))))).)))).)))))))))))}}.}..)))))))).........))))))))||{{||{{|||||||..,,|||||},{{|{||||,,.,{{..,{{{.((,,((,..((,,,..((....,||,{,,,}|,.|}|.||,,||,|}},.}}}})))).....)),}}}}},....,|({((..{(((({{{|,,,||{,,,...)))}}},,,..(((.(((((..((((....))))..))))).)}}...((((((....))))))..{|,|{{(,.,,.,,|||}|,,.......))))))}}}.}}||......(((((((((({..{{{...|||{.{{({{|,..{{{{{{,.,,(((((.....))))){(((......))))..(((((........)))))........(((((...,})))......|}}}}}}}}}.)))}.,))).......{(((..|.((((((.,{{....,}})))))).,.)))}.})))))))))).,,,,{(((({{{({((((((({..(((((,....).))))))))))))))}}}))))))))})))))}))))..)))))))},||,.....,....))).))))).}.))})))))))))...,))))}}.}.},..,.))}}))..((({(({..(({{...,,|,.{{{{..,,.}))).}}}.,..}}}}..})))))}(((((({,....,,,(((((((((((((((......,(((((((((((((((((.....))))))))).((((((((((.....)))....))))))).((((((.((((......))))..))))))......{.((((...((((((....)).))))....))))}((((..(((((({(((((((((({...((((((({...})))).}))....||,,.(((((...,..........)))))(((((((..((((((.....)))).))..))))))).(((((((.((..((((((..{{(,,.......,}),,))))))..)))))))))........(((((({...{(({{((((,(((((((((((.(,.((((,((((..(((((.....)))))......,,,..,{,((.((((((({,|{{((,..,,,....((((((...((((((,.(((((((({,,((.(((.((((..((((...(((({,((.(((((.....))))).......)))))))...)))).)))).))).)),)}.}))))))){{({,....}))),.....,..((((((((((((.............))))).))))))).,,.............,))))))..))).))).,...................(((({.{{{{{{...,,.}|||||,||}}|.{{{(((.({.....))}}}|||.}}|||,|.,}}},,))}}}...,,.....{(((((.....)))))}..,|,,}},,}})))))))).}.}||,|(((..,..))))..,...}}||,({,.((((((({....})),,))))...}||.}})))))}.|).))))|((....}}...(((.{((...((((({.(((.(({....((((((((((....))))))))))))).))).})))))...))}.))){{{,(.((((((.((.((((,,..((((...(((.((((({,((..(((((((..(((((.((((....{((.(((.......}.}))..,}}}..}))).)))))...)))))))...)))))))).((.((((((({,{{..(((((....)))))(((((((.(((....,....,...))))),,)))).......}})},)))))).)))))..)))),,.)))).)).)))))),)))),}.(((({...........)))))..,)))))).....))))))))))))))).,,....,,}..)))))))))))))))))))))((((...((((.....))))...)))))))))))}|(((((((((((((((({{(((((((((....(((.....)))..,{{((.{(((((((((.(((((..(((((.(((.,{((....||||,.((((..((....(((((.{{{.,{{{((((((((,.(((({....}}))}.)}))))))))...,....,||,....,||||,|,.}})},))),.)))))...))..)))}{{{.|,,}}},,}}))).)))))..))))).(((({.{.{((((,,......))))).}.})))).......,,{{{..,|||}..,||....(((((({,,,.{(((({..({........))..))))))))))))..}}||,,||||,..((((((((.(((((.....))))).........))))))))..,,...})}})))}}}.....,,}|,((((((........)))))).,.((((....((((.,...((((.(((((((.........))))))).))))...},))}})))))}}}}}|{||||{.,|||,{|,......}}.}}}.}}}}}}..(((((((((((((,,..(((((.((((((......(((......)))........)))))).)))))(((((((.((((......))))))))).))......,{,,(((((((.....)))).))).........((((((((((,,,,.(((((((((.......)))))))))..||(((({.....,))))).((((.((.,......(((((((((({,{((((((((((...((..(((((((.(((((((((..,,,{,{{{||.{((...,.((((((((.,{(((((((........,,,,}..}}}},,))}.,.....(((.((((........)))).}))......,.)))))))).,,......(((({...{{...((....)),....}}............{({{(((..{((.(((((((((((((((...(((((............{((((.(({{.(((((....)))))....,|||,,,..(((((((.....(((((((..((,{((,...))),.))..)))))))..)))))))..,|}|.||,,{{{|...})}},}}})))).)})))...(((((,.(((((((((((.{(...........}).)))))))))....)),.))))).)))))..)))),.})))))).))))(((((........)))))...........{(((((({,..{..(((((((..{{(((,((((((...}))))),}},,,.{(((((,,...,})))}}.,,,....,,..,|||,.{(({(,,..,}))},.,}|((({.,.(((((.(((.......))).)))))...))))})}),)))))))......,.,))))}})))))}}}...........((((((..((((({{..((((.(.((((((((((.((((((((((((((({.((((.(({{({{{(((((.,..(.({(((,((({{..((((((,,,,,((((((((.{,....,}.))))))||.}||}|}{(((((((((..(((((.,,.(((.((...(((((((((((....,.{.({{{,{((((....,})))},,,,,))),,....)))).....,,..........,|....,..(({{,,..,,,}|||},..,,,{((({......))))}))))))).)).)))......))))))))))).)))|{{{{|{{.,,,((((((.((...(((((((((((..(..((((((({..{{,,{{((,,,(({{{.{{{{.,,,,,},..((((((..((((((..(((((((((....))))).)))){(((|,..((((((.{{{..(((.......(((((((((.,.........)))))).))),{..,,||.....,,{{{.....,},,,,....((((((.((,,((((((((((.................))))).)))))))).))))))((((.(((..{{...,)}..))))))).(((((....((((......(((((..(((((..(((((((({(((((((.,...........,))).))))..})))..})))).......))))).)))))...,,))))....))))))))..)}})))))).,|,||...,,,(((........}}}.(((((((.{((({.,{,.,||,.((((((((((((((((,..{{({.{,.........((((((........)))))}..}}}}..}}}}.,,,,......((((...))))......)))))).))))))..,......,............,))}..))))))).......}}}}}))))))..))))))..}})}.})))),..}}}}.,,......,,.,(({{{{,..,.))))}}.{({{{..............))))}..,},,..(((((..(((.((....)).)))..)))))..,.)))))))..}..))))))}..))))...)).))))))..{(,,.,||{{{{{..........}}}.}}(((((((.(((....(((((........(((({..((((((((.,,..,..........((((((......(((((((((..((....,{{((({({...,.||.........})},..,,|||((((((((..((....))..))))))))..}},....((((((.....)))))).........((((..................))))...,,,,...)).)))))))))..))))))........(((((...((((((..........(((......)))........)))))).....)))))..,},.}}.)))))))).)))))....))))).)))))))))).....,)}}))))}))}..))))).)),...,||,,}}}}}.}}})),}..||,{,,{({.,,,,.,,,|}||,,...}))))}}.,)))}))..)))).})))))|((((..,,{{{((..{{{.{{{{{{{{{|||{{||,|,|.|.|})),..}}}}|||||||,...,,,.,}}})))}}}....,{,{({|({,,.,,,,,}.,},....})))).)))))..{(((((..((.(((((((,....,,........,.|||...||..{(.(((.....))).))|||||...{{{......,||,))}.,})})})|,,.|||,..,}}.,|,..}))))))...))..))))))))))))))))))))))))).))))),}},)))).....}))))),,...)),,..))))))},{{{......{,((((((,..{(((((({{..................}},))))))))))))).)...,,,{{{{|,....,,,,,.{,((((((....((((((...((((((((((((((.,,.(((((......))))).((((((((..((((....))))..))...))))))(((((.{.((((((((((.........,....{(((,.......}}}..(((({{,,,.(((((({{{({..(((((...})))),},,.,,)})}....)))))))))))))...))))))))))...)))))........|{,..{{{,.....})}.,,.)))))))))))))).)))))).)))))),|,}},..((((.((((....)))).))))}}}}}}},.((((...(((((((....)).)))))..))))((((....((((((....))))))..))))(((((((((((....(((..(((((..((((,,.(((((((((((((((...((((((..((((.(((...((((.(((.......))).))))...))).))))......)))))).,{,,.{{{(.{{,...}}}.}}}}|}}...,.......,,(((((((((....{({{.(((((....{{..((((.{..(((((((..(((,,,{{{{{{(((((((,......{(({.......}}}.........})))|||.{(((((((((((((..(.((((.((......{{.((..((((.(((.,,......))).))))..}),}}......(((((((((((.,...........(((((((((((((((((,.{((.(({{{((({(((({,......(((((((...(((((.....(((.(((.(((((...(((......,{((((({{.,.((((,,..}}))},},((((.(((..(((((...(((((((({....})))))......{{.{{{..((((((((((((..(((((((((((((..((((((..{.((........)).,...))))))..........(((((...(((((...(((((((((.(((((.......))))).)))))).)))...)))))..((((.(((,,.{.({{.,||{{..{{.....}}..}))}})).,...))).))))...)))))((((((....(((((((..(((((.(((((((.((((..,......,.)))).)).))))).)))))..)))))))...)))))).(((((..((.,.....(((....))).....,.))..)))))...)))))).)))))))..))))))))).)))..})}..},....)))...)))))..)))))))....{||||,,,,,.|}|||...|{{,.........|,||....}}}.,,..,..((((((....((((.((......(((((....))))).....)).))))....))))))..{(({{((((((......)))))}..,)))}}......)))...))))).))).)))......((((((((.,...,..,.(((((((((,{((.(((((((((((((.{((((...((((..((((...,,...((((........)))))))))))).))))}.....{(((((((((((...(((........)))......)))))..{{....}}..)))))))...((((((.......))))))))))))))},)))).))}.,,,{{{.{,,{{{{..,))}),}}}}|,,{{{((({..(((((((((((.((((.((((((((((((((((((.........))))))).)).(((((((.{{{...(((({...}))))..,,}....,,........,}.)))))))...........(((..(((((((((....),})))))))..))).((..(.(((........))).)..)))))))))))..))))....))))).)))))),.}}}....((((((.((.((((((..........((((((((....)))))).)).{{((((........))))}|(((((....)))))},.....)))))))).)))))),}},|||.(({(,,,...)))).)}..)))))))))))...,|..,...}.).))))))))(((((((.(((((.((.(((((....(((........)))..)))))))))))))))))))..........)))))))))))){(((..((((((((((....((((....)))).........((,(((,.,,|}},})||{|||,..,))}.}}}....,)))))))))).))))||||.|||||..(((.(((....))).}}},,|..,|||{{.((((.(((((((((.......((((((...(((({(....,,)},.,)))))))).....))))))))).)))},}}|..,{{{{,|{......)),)))))..,|,|}}},.))))..})},))).)))))))))).))))).)))))))))))))))){((((((((((........))))).)))))}({(((((((.((((.........(((.....))).........)))).)))))},}}}}(((((((((.{(((..{,..{(,,,,,,..(((((((((.,,,,....,,,.,.||.{{.((({..||..,.,),,),)).,),})}}(((((.((..,{.{{.{((...(((((.((...((({..{((.((((((......((((((({.,,..,((....))|{,{((((((((...,,,,..,,|,..,{{{{{,,{,,,{{{.............,.,.,{{{{{{{|||.....{((,.,|{||||(((((((.{........})))))))...{(((((...((({,{{{(,,,{((({{.....,,...,}}}}}}.....,|..((((((({.........(((((((((,((......(((,......((((((((..(((.(((({|((((({..{((((((.((((,{{,.{{.,...{{,..,,,..,||,.......,||||||,(({...((((((((.(((((({{..,..{(((((((((((((((({{((((((....}}}}},..........(((((.(((({{{{,{((,((({..,{.,(((((((....))))))},,...,{{,.{(((((.....((((((..((((,,.{....,,})..)))).)))))).....)))))}.}}))}}.)}}||,,...((((....)))).((((((......(((((((...((((...))))...)))))))..)))))).(((((((((,((.(((((.{,....,}.))))).))..,(.((((.,..((((..((..(((((((((..{{.........((({,(((((((((.((.((((((((......(((......))).....)))))))).))...))))))))))))).......,}..))).))))))..)).))))...)))).))))))))))).....,,........,,|{{{..{{{{{(((((((({.{{|{{.....,}|...,,,...(((((((..(((((........,(((.{{{....}}}.)}}........))))).})))))|{((((...((((({..((...|},.})))))....)))))}.((({{|.,,,,.}}}}}},},}}}}.(((((((..(((({,...,,,{{.(((((((((((((.{{{.{{,{{(({{{,,{.(({{(,((({{{{...........(((((.((((...........))))...))))).............,{{{{{{{{{,,,|,|,|{{||{,.,{{{{,{|{{{||,,|{{.......|||,,..,,}}}}}}}}.,,,.,,..,,,,,.,{(({{,..{{,,,.....,|||}..,|||||..{{{,{,(,{{,...,,,,.},||,|))}.,},,},,...}}}.}}},|}))})}..|,|....,.{(((((((..((.(((.((((((((((......}))))))))).))).)).....,((((((((((((......))).)))))))))|(((((,..(((((,....(((((((........))).))))...))))).....,.)))))}.(((.((((((...........)))))).))).)))))))|,....|||......,},.},}}}||||,(({{,.,.{{,........))}}|||(((...,))))}},,)})}})))})},}})}}||,{{{...}}))))))).....|||||||{{..{{,((({....,||||.}}...{||||,|{{.,})))))))))||,....},,.....((((((((........)))))))}...{((((({......)}}))))}.|{.(((({,....))))))}},,,|||}}}..}))))))))))))|}},))))))))))))}.....{{{((...{((.....,,,..}}}..,}}}},})))))))).})))}...})))..}}||,.(((((.............)))))..)))))}}.)}))).....,}}.))))))}..,)))))))))}..|..}))}..)))).))))))))....}}}.,....,.)))).))))))).})))))|{{{.((((((((.(({{....}})}......((((((((((,,...,.,(((((.....(((((((((((...{,......})....)))))))))))..))))),,,|.||.......,(((((...((((((.(((............{,.((,,..,,.,,.,|||,||{{{{{.,...{{.....||}}}}}}},,.}||.,,,((((((((((,(((((((.((((((,.(((..((((...))))....))),.)))))){(((((.(((((((((,,...(.{({...|},|},....})))))))}..)))))}.,.{{....},......{((((((((((((,(((,,(((((...((((((((({.{(((((....)))))}..,,||||{{{,,,...,},........{,,,....(((({....})))).......,(((((((((((,,.,..|,,,,.{((.(((((((((..{{((......})),...)))))))))))},{{{{{{.....}}}}},,,{({((({{,({(((({{{,,..||,||||}}{(((((((({{{{{||,((|..|{(({.....{(|(((|,{,{(||,{{{{{{{{({{{.{,({{(((((..{{,{,,{{{.{((|((({,....,}},}}...,,{{{{,|,.,|,|}}}}{{{,,,,....))),.,,|{.{(|{{((({({{{{{{..{((((,,..........,,.,,..((((.((((((,...{(((((({((.{(({.,...{,(((((.((({{.(({....))}..,,})).))))}.|.......|.{((((((((((((.....((((((........((((.....)))))))))){{{((((((.....((,....{((((({(((.........)))}.))))))))....)))))).......})}..((..(((((((.(((((....(((((,((.....{{{,{(({.((((((,..(((((..(((((((....)))).....)))..))))).,.)))))).))))},.((((.....))))....),)))))..))))).)))))))..)).....))))))))))))}})}}.}})..))))))))))))).)))).....||,....,})},,,}})}}}|,|||||}}..,))))}},))..,}}||,||,...,.....}}|||{{{{|||||||,..,,.,,|,.,,,,,||||.|,,,,|||{{((((,,{{(((((((,.(((.....)))......,(((((....))))}.||{{,.{((((((((((.....,,..((((((.(((((........))))))))))).........)))),,)))))}.........,,.,....,}}}....{{{.((((((((..(((((....)))))..{{..,...,...||,....},|,,(.((..,...)).)))}......,,,....((((({..,.....,)))))).(((((((((...((((((((((..((((.,..((((...(((......{.(((((((.((((.....(((....(((.(((((((...(.((((.....)))).)..))))))).}.)).,...)))..)))).))))))),....(((((((((.(((....,.,....||..,{{|}.....))},.})}.)))))))))...)))...)))).....((({.,....}}))||,((.....||((({.((,,,({((((,,(((({(....{((((.{((({{,,,{..{({(((({(((((.(({{,.,||...,|||,,|||,|,....,,,,|,..,|,,|||..{|||{{,},,,,.},)))}}}.,)}}}}}||,,,.......||.,}}}..))),,}}))}|}||},||},,,,,,....,},)))}))}}))....(((((((..{..((((((.....))))))..}..)))))))...(((((....))))),,.,,,,.,.((({(((((....)))))..}))}.{,,||......))))))}}|..|},|,{(((((((((....))))..,))))}},.||.{{{{|((((....))))},))))}..(((((........))))).(((((((({((((((.((((.,.(((({({{....{,,...,..)))||||..}}))),)))).)))))}|{{.....}},,))))))))..((((((.((...)).))))))....{{{{...}}}}.(((((......))))}.(((.((((((...)))))))))...(((((((((..((((.(((((...)))))(((((((,(....{{{((((((..(({..(((({.((.((.......(((((.{{.....}}.)))))......))))}))))))).))))))...}))..,,.}.)))))))......,{{..{,.....,{||..,}}||}}}},,..,,(((((((((((((..((,..((((.((((.((((.((......)).)))).)))).)))),.)}..))))))))((((((((((.,((,.{{{{{{...........,,,,,......,,,...}}})}}(((((((.((.{{{(((((((.((((.((((.({..((((((((...(((,....(((((.....)))))(((((.....))))).......(((((((((..,.(((..((((.((...((({...})))...))..))))......))).,.)))))))))......((((((((..............))))))))...,.)))..)))))))))}))))..))).).)))))),........(((((((((((((((((((((..{((...,..........{{({...}))),(({...})).((((((.........,{{...,}}.(((((((...)))))))..)))))),((((..(((((.((((.....((.(((.({{((....))))..}.)))..)).....)))).))))).))))|((((((.((.(((.......((((((....)))))}..(((((....))))).(((((((({(.(((.(((((,((({...,||..(((((((((,((((((......))}}})){(((((((...{{{{,...,}))}........)))))))}.((((......)))),,.........((((((......))))))..(((((((..(((((.....)))))))))))).....,,.,,,))))))))).....................{.(((((((((...,(,((((((((((({,{(((((({....}))))))||{....||||,,,.............,}||,.{||.....,),)))}},.}},,}},.}}.....))))))))).|{((((((.,.........{(((((((..(((((.((((....|{....}}.)}})........))))).))))))))..))))))}.,,....(((.((((...........))))))).......{{||,....(((........)))(((((((......)))))))|||,.,..,,}}})}}}})))}..))))))))...}}.))))))))...((((....(((((.....((.....))...)),,)).,..)))),..{(.((((((.(((.((.....)))))...)))))).)}........((((....)))).))).)).})))))}.))).))))))))......)))))),,))))))((((.((......)).))))....{(({.......}})}{{.(((,,..{,|,{{{{{{{({,..((((((((((....((((.......((((..(.(((..(((((.....((((......))))..)))))..)))...)..))))(((((((...}))))))............)))).....)))))))))).|||,...(((((...)))))}}|,(((((((..({((((.(((((...((........))...))))).)))))))))))),)))))}})))})}}.....,,,,............((((((((,......))))))))....,}}}))))))))).....{{,...,|}.((((((....)))))){{((((((.((((.(((((((.((((((((...)))))))}..{({.((((((....(((((.((((.(((((..((((....)))))))))......{({(((((.(((.((....)).))).))))).))..))))))))).......)))))).})}..))))))).))))))),..})))}...,)))},)))))))))).....((({,((((......))))))))......))))).{(({...........((((....))))...........}))}))))...))))))))).....)))}}}...}))))),,.}})))),),))))..))))))))))(((.({.,{{..,....)))..}}.))).........)))))))))..{((((((((({....}))})))))))}..................,.)))))))).})))))))),}))))))),.|})|})}}},}}}|||||.,}}||||.(({||||},.,|||{.}||},|,.....,,.,}..)))).....,}})))).,,..,},}}}|||,.{|||.{,,.,}),))}}..,,.(((((((.((.....)))))))))....}}|||}|,,|||||,|{{...,|,|||,......,,,}}}}|},}}|,,..,}))}}|.......,,,..}))).}})))}}))),},|||.,.,|||{.|||||,|.,|||.....||..,,)),....,,,,,.}}}}}..))}}.................,....{|||||,|||}.....((.(((.......))).))..,|})}))))}}.((((..((......)}...)))}......,{|,{{{.{{{......))).)))}).|{{|,,,,.})))}}}||||||,|||||||{|,...{{||{|,|||,.}},...,}|||||.}},))))).,})),,,,,}|||{|.||,,,.,||,....||||},|}},|{(((({.,.))}}}},..(((((((((.(((.(((......,{({{(,..,,....}})))},.,,,))))))))))))))).(((..(({...)))..))){{{.......))).(((((({...)))))))..}}))))))))}.,..)))...,))}},.))))))))))....)))))))).}.......})))))))))))}..(((((.,,.{{(({{{.....,,{{{...(((((,.....|,}}}|,.....,||,(((((((,({{.,(((({,({({{((((({{....((((({.{((..(((((((((((({(.(((((.((...,,),...))))).))))))))))))){({...}}}..(((,..,|||..,{.{{{({..(((({....|})))....}})}},||||||},,,|||{..||||...|||.{|||(({((((,......(((((.(((..(((((.((.(((((((((........)).))))))))).)))))..))).))))),,,}||}}}}.....,,((((....}}},.(({...,,.......}}}|((((.......)))),|{{....,|||..|||,,,.,..)))},......})))))}).,..,.))))))).,,.......,)))))))}((((.{((....))}})))|.|||.}}}}}}}.,,|{,.....}))..,,.)))}))),,,{{,{{{||||||.,.,..|,||,||||,{{{{,.|...,,,|.||}||{{{{{,{(({.{{,....,}}.,}}}.|||||{.{{|||,||..(((.(((...(((((((..((((......((((((((........))))).))).........,..))))..)))))))..))).))),,}},}}}},,,.......||{|||.,|.....,,)),}).},),..}}})),,||}}}}})))),,....{(((((({,....,))},},))}))).}))))))).}}.}),))))).)))))))..,)))))))))}.,.,}.))}.}))))}.))))))))))))))))...})))))))|.(((((((((((.,{..((((..(((((((....))))))))))).((((((((,{((((.((...((((...(((...)))...))))...)).))))))))))))).....))))),)))))),................,{((((((..{{{((,(({(,,.,||}}.,}||}..)),}}}))).,||..,}}}...))}},,.....((((.....))))((((...|,,,,{{{{{....}))))).....)))).))))).))).)))))))),,,,|||..}))}}......))}....,.}).)))).)))))))))))))..},.}))),))))}))))}.}}}}},..{(((((((({(((((.....)))))............,...{((,((((((,..(((((....}}}})..,|||,||}.}}}...,,}|{||.,{{{{,,(({{{{,,....|||,,....((((....))))..||{{{,......(((((((((.....({.((((((..(((..((((((......,.((((.(((((((.....,.,.{(({{,.{,,,......{{{{{.(((({((({...}}}.})}}}}.,,..},)},|}}))...((((({,{({..({{{{..|,,||||{{{.|,...)))}}).....{(((((...(((((((...(((.{(,..(((((((.{({{((((({.{{...{{{(({,{{((((((((.{.(.....}.}.))))))))})).(((({.((((({.(((...((((((((((,,,..,,.{{{{{...(((((.......(((((..(((..((((({...,(((((((((((((.{,,...,..,{{...)))...}.))))))),...(((((......))))),)))))))))))..)))......)))))......))))),,,.}}}))}.{{,.....,||}....||{(((((((.(((,.((((.((((..((((.,,((((.{{{{{{|,|{(((((((({.{{{..(((((((((....}}})))))}..,,...{||{,{{||,,.,{{,,.,|,,,{..{{{..||.....,,.,,},..,||,.,{{..,{{({{.,...,{,,......(((((.(((((((.........,,,((((,,((({{{{({{(((..((((((((((....(((...((.(((.({{(((....((((((.((((((...(((....,.((((...(({{,{((((((((((((.....))))..((({,,.{{{((((.((..((((.......))))..))....{{((,,...})))((((((((((({.,,.(((...))).....((((((((((((((..((((...((((((((((({,((.......)))))))),{{,...{(((((((....((({...}))}..)))))),.,((((((.((((...)))).))))))..,{{{{(({((,....,,|||,||.,,|,{,||,,..........,......,|,,......,|||{.{,.|||{,........,,,),)}}}...)))))),)}..,,,.....(((.(((((((((((...((({...||})|.{(((..{((,,,,||}..,,|,,,,.,{{,,((.,((({..((((((.(((..............))).)))))|,,,.||,..,|,,}||,,,},,,.,{{||..,}||,|..||.}||....,,||.}}..|||},||||}}....(((.......))),||||.,,,....,))),.....,|||}}}},,)))}..((((((((((...(((((((((((({...(((({.{.......(((.(((((((.,,..,{{{{,,.{{........},.}.)))......,)).))))).))))))))))))))).))))))).....)))))))))),}||......{((({{{((..((((((((((....((((((((((..((((,{{,((((((.((((,.(((({((.,,.||{|||..((((........)))).,({,{{{(((({.((((((,(,((((.(((..{((((((((((((((.(((({.((((,....}))),((((((({....,..(((,,{{{(((({((.({,,,,.,{,..,,))},}}..,|||,||||||.,.|||((..(((((((,...,)))))))..},.....{{((({(((((((......((....))...))))))).)))),||(((((((((((...(((((({{((.(((.(((((((.,..(((((.(((((({.,...,{({{(.,,(((((((({{,({,,,,}.}))}))}...,.((((((.(((((.........((.....,,.}}.....((((..{........}..))))))))).))))))(((((((.......(((((.,....((((.((((.((..((((.(((((............)))))))))..)).)))).)))),,,)))))))))))).,|||,||.||||,.......|})},.,..))}},,|}},|,.}}))}|((((((.((.((((((((((((.......}))))){((((..((((((((({.....,}}}}}}}}))..}}}}}....)))))))).)))))))...,,{{,{{{.,,||....||}}},.((..(((((((((..((....))..)))}))))))..))(((((.......)))))....,......,{{,....}}}{|||,,|||||||||...,,.}}}....(((.((.(((.....))).)).)))....,,},))))))))))))..,.))))))).))).|}({(|{(({(({.,{|.||..|||.,,{......|||,{{({{{((||.,.,{(((({((({{((.....((((((..(((.....))).))))))}})))}....,))})))|||((((..,,,||||{...,|||||,}{{{.,,,))}....((((((..{((((....((.{{(((((((.,,...,...))))))).,,.}}...))))}...})))))...{{{{,.....,||,}}...(((((.....),})))..|||.........,}},}}},.}))))}}.....(((((.,||{.......,,).)))))....(((((((.......))))))).{(..(((.{(.((((.,,{({,({{{|(((((((((....))}}}}.)))))....}))))}},}.)}}).)}.))),.)).})}})))))....)))))))}}.}}||,,{{.,,,,..}}}}},}}|}...,|((((((({(,((({{....(((,..{|,|{{{.{.{|||||||||,..((...{{{...............)))...))..)}}})}})))).).)))),)}.(({.((((...(((...({{........{,.....,..,.......)))...)))....)))).}))(((....)))....,,......,{.....}}....}))}..))))))))..)))))),,|||,,},))....))))))))..,,.)))))))}),)))}...,.|{{||,,..}}.})}}...}))))))).,...))}.))))...}},,)))))).}))))))}}}.,{{{.{,,,.,{..{||.|||}|)||||,,.|,..(((((((((((.(({(((((((((.{{{({......{{{...,,..{{{{{....})))),.,{.,{{{|,.,.))))))}..,,.}}..)))).)))))..)}).}}....)))))))))....},.)))))).,}},))))))}}}}}....((((((.,...,.)))))}{{{{(((....({{{{({..({{((((((......((((((..(({,{.,{.{({{(({((,...,,}},.)))))),..(((((..((,....,))))))).................}}.))))..)))))){{{{,,,.......}))).,..)))))).)))|(({...)))).........))))))...)))))))...((((.....)))).))))))(((.((.((.......)).)).))).(((((....)))))..(((.((((....)))).)))......{{({{....,,}},....,,{{.{.(((....))).}.}}))))}))))..))))).)))))....))))))))))..)))))))).,,},}})))}}}}}))))))}}))))..))))))))).)))))))))))))))))).(((((..(((.....))).)))))...((((((......(((((.(((..(((,.,,..(((.((....)).))).....)))..))).,.,))))...))))))..)))))))))))).(((((.(((........))).))))).....((((((((.((....))))))))))..,{((({.{{{...........)))))))}}..((.((((.((((.(((....{{{(((,,,((.(((....))),},.}})))),,))).)))).)))).)).....))))))))))))))))))((((((((((((((({,..,,,}},{((((((((..(((((.(((.((((((((((.(((...,{........,,.{.(((...........)))}..((..((((......))))..))((((((((((((((((((.(((((((..((({{..((.((((((.......))))))))..(((((.((...(((((((((,,{(((((((....,((((((((,((,,,,|}}.}}|||,}}}(((.....))).,,|||,..}))))},..})))))))))}{{{{{{{({{{((({({....{,,.(((,.,..},}},.|......{{{{(((.{{{|||{,|{...,.||||...{||,,,,,))),...}))),),,|||}.,}),))...||||{{{{..{||||,|{{(((({.....,|,,,...,.{{{....{{(({(({{.,.,,.,.{({{({,.,,....((((.((,{(((....)))))).)))).,,,.))))}}.....})))}})))))))).))},)).,,,,)))))})),))).)))...)).))))).....,{{{{{{,,...,,},}}|||.(((((((..((((.,,((((({(((.(((((((........(((....)))..)))))))..))}.,).)))))...)))).....))))))).}}|,,|||||,..{((((..((((.........))))..))))).||||{..{{..,,}}..)))}|((.(((..((((.....))))..))).))}.}}))).......((.(.((((((.....{(((.((((....))))))))....(((.((((((((((({....}))))((((((((...(((((({...})))))).(((((....)))))........(((((((((........(((((..........(((((.{,.,,(((((.....((((......|((........))).....))))}))}).},.))))}(((.(((..(((........)))..))).)))))))).......)))))))))....(((((..((......)}...))))))))))))))))))))..))))))))).).))...))))))).....))))).))))).)))))))).))).)))))))))).))).....)))))..)).))))))))))))).))))))......,))))..))))..)))...)))))).))))))...)))))))).))...)))...,...,..{...,.,,...(({{,|{{{,.,,}}.)}}},})}})))))))))))))|(({.{((,,,,,..}}|}}},.{{(((((.......))))).)}....)))))))))))))...(((((......)))))))))))).))))){.(((((.(((((......))))))))))}..............,.}))}.}.)))))}......{{{{(((((....)))))||||,{,..,,......)))}},)}}}}}||..}})|.}}}.)))).}}).)))},,})}),......(((((((((.(((........((((....))))...((((..(((....)))..)))).))))))).))))),))))..)))).)))),....}}}))))))),)))))))))))))..))).}))))).}))))....,.((.(((((((((......)))).))))).}),...((((((......)))))).(((.....))).}}.}))),)}}|..{{||,,,,,)))},.....,|||.{{{(({({.,.{({((,..,,{||,..,,)}))))).}|||,.,...,,,,}.}})},,)))))))},}})))...)),}))))....)))))}.))},..}}}}}..}}})))}},,{,.,{{||,{{..{|||||...},}}}.}},|}}||{||...)))),.,}))))))).)))).,......)))))).)))..)))))).},...)))))))))..,{{||||||....}}}}}}|||((((((,...,}})).}}..,.})).,,.,)))))))))))))))),.....((((((.((((......))))))))))})))))))))....{(((({...)))))}|||{|,..((((({...})))))....))))}{|||,,,...))}}.)))))))))},....))))))))}))))))...)))...)))}..)).))))).,,.))).)..}.)).))))}(((((((....))))))).))))))))).,|||||,,,,,,...}))))},,,.)))}.))))))))).)).)))))..))))))))))))))}},.....,{|,,,|||.....||}...}},.{(((((.................))))))}}}})))))))).)))))))..}.))))..}}......{{....))..(((((.(({...))))))))...)))))}))).))))))))))))))))..}.)))))))))))).)))))..))).....))))))))))).........,,,|..}))))..{{{{{....))))))))..))))))}))))))))).)))))))..))))))))))))),,,.,(((((,...{((((....)))))))))))}))).}))))))......,))))))..)))))))))).)))}..)))))))))))))...))))))))))))))),.......}))))..........)))))))},(((((...(((((....)))))...)))))(((((......))))).))))).))))))))))((((((.((((((..,,{(((({.,{.......,,}})))}||{(((....}))}}}.)))))).)))))).,|{{{{..,,....,,..}})}))))))))..

Transcripts

ID Sequence Length GC content
GCAGAUGCGCCGCGCAGCAUCCCCGGUGAAGGCAGCGCGCCGGUCCUCC… 18005 nt 0.4299
Showing 11 to 11 of 11 entries
Summary

This gene encodes a member of the plakin protein family of adhesion junction plaque proteins. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the full-length nature of some variants has not been defined. It has been reported that some isoforms are expressed in neural and muscle tissue, anchoring neural intermediate filaments to the actin cytoskeleton, and some isoforms are expressed in epithelial tissue, anchoring keratin-containing intermediate filaments to hemidesmosomes. Consistent with the expression, mice defective for this gene show skin blistering and neurodegeneration. [provided by RefSeq, Mar 2010]

Forensic Context

A study in human keratinocytes and mouse skin demonstrated that X-ray irradiation (5 Gy) significantly downregulated the DST (0.53-fold) alongside 58 other genes, while upregulating 16 genes including ATF3, which was validated to induce caspase-3-dependent apoptosis [Koike et al. DOI:10.1269/jrr.46.173].