| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGAAGGACAUUUGGGCUGUGUGUGCGACGCGGGUCGGAGGGGCAGUCG… | 2013 nt | 0.5524 |
The protein encoded by this gene is a phosphatase with dual specificity for tyrosine and threonine. The encoded protein can dephosphorylate MAP kinase MAPK1/ERK2, which results in its involvement in several cellular processes. This protein appears to play an important role in the human cellular response to environmental stress as well as in the negative regulation of cellular proliferation. Finally, the encoded protein can make some solid tumors resistant to both chemotherapy and radiotherapy, making it a target for cancer therapy. [provided by RefSeq, Aug 2017]
A study in human dermal injuries demonstrated that the DUSP1 mRNA showed an initial decrease in expression during early healing stages followed by an increase, peaking at 3 days, and was detected at all sampled time points from 0–2 minutes to 6 days post-injury [Palagummi et al. DOI:10.1007/S00414-013-0941-5]. In a separate human study on acute myocardial infarction, the DUSP1 was validated as a differentially expressed gene significantly up-regulated in patients who developed heart failure, with RT-qPCR analysis showing it provided good predictive accuracy (AUC 0.847) for distinguishing this outcome [Liu et al. DOI:10.1042/BSR20222552].