Basic Information

Symbol
DUSP1
RNA class
mRNA
Alias
Dual Specificity Phosphatase 1 CL100 MKP-1 PTPN10 HVH1 Mitogen-Activated Protein Kinase Phosphatase 1 Dual Specificity Protein Phosphatase HVH1 Dual Specificity Protein Phosphatase 1 Protein-Tyrosine Phosphatase CL100 MAP Kinase Phosphatase 1 MKP1 Serine/Threonine Specific Protein Phosphatase EC 3.1.3.16 EC 3.1.3.48 CL 100 VH1
Location (GRCh38)
Forensic tag(s)
Wound age identification Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_004417.4
Sequence length
2013.0 nt
GC content
0.5524

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-764.50 kcal/mol
Thermodynamic ensemble
Free energy: -797.04 kcal/mol
Frequency: 0.0000
Diversity: 572.75
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((((((((((((.(.(.((((....)))).).).))))))((((((((.((..((((((((((((((.(((.(((((((((((((...((((((..(((((((((...)))))))....))..))))))...))(((((...(((((((...)))))))...)))))....(((((((.(.(................).).)))))))))))))..)))))((((.(((((.((.(((((.((((.(((((......(((((((((..(((....)))(((((((((((((.((((((((.....((.......))..))))))))))))))))........((((((......))))))...........(((((((((((((((((((.((((((((.(((.((((......((((((((((...(((.((.....))))))))))).))))))))..)))))))))))...))))..))))))))...((((..((((.((((((((.(.(.(((((...((((((.((((..((.......))..)))).)))))).)))))).))))).)))).))))..))))(((((((...)))))))...)))))))...(((((((......))))))).)))))..........((((...))))(((((.......)))))..)))))))))...((.(((.((((.(((....)))))))))).))..))))))))).))))))).)))))))))(((...((.((((((((.((((((((((...((((...))))...((....))....((((((((....(((((....))))).......)))).))))...((((((...((((....((((...((.(........)))...)))))))).))))))((....))(((((..((((..((((((((.....(((.(((.((((((((((((.....(((.((.(((..((.(((((((((((........))))))))...)))..))..))).)))))((((((.(((.(((.....((((.....))))))).))).))))))....))))))))))))))).)))(((((...................))))).))))))))..))))..))))).).)))))))))(((((((((((((((((...(((((.(((((......(((((..((((((....)))..........)))..)))))......))))).))))).................)))))))))))..))))))......(((((((..........(((((.(..(((....)))..))))))(((((....))))).(((((..(......(((.(((((....)))))..)))......)..)))))))))))))))))))).)))))..................))).)))))))..)))))))..)).)))...((..((((.....))))..))...(((((....)))))...((((((..(((((...(((((((..((((((...((((.(((((.(((((((((((((..(((.(((.....))))))..)))))))).....)))))....)))))))))..........))))))..)))))))..)))))..)))))).(((((.((((((.....(((((.....))))).....)))))).)))))..))))).))))))))..(((((..((.((((((((........(((((.........)))))......((...(((((.............)))))...))...((((((((.((.....)).))))))))((((......(((((((.((((......)))).)).))))).....)))).((((((...)))))))))))))).))))))).........(((((((.....))))))).((((((((.............))))))))...
Thermodynamic Ensemble Prediction
{.(({{({(({(({((((((.(.(.((((....)))).).).)))))){(({,{{(,((..((((((((((((((.(((.((((((((((({(,{,((((((,.(((((((((...)))))))...,|,|,}}}}}|.,.,{(((({...(((((((...))))))),,,|}}|||{,|{{{{|{{||.,....,....,,.|,.,||||)))}}).}))))).,)))})((((.(((((.((.(((((.(((,,(((((,.,,,.((({(((((.,({{.,,,))){{{((,(((((((.((((((({,...{({....||.}}.,})))))))))))}}}|,...,...((((((......))))))..}}.....,.((((((({(((((((((((.(((((({{{(((.((((,.....((((((((((.,.{((,{{.....)}})})))))).))))))))..)))))))))))...))))..)))))))),..((((..((((.((((((((((.(.(((((...((((((.((((..((.......))..)))).)))))).)))))).)))}),)))).))))..))))(((((((...)))))))...)))))))...{((({{{..},,.)))||||,}}}}}...,,,....((({...)))|(((((.......)))))}.}}))))))}..,,,.{{(,((({.{((,,,,)))})))))).)}..))))))))).))))))).)))))))))(((...((.((((((((.((((((((({,,.((((...)))).,{(,,{,.||,,.,||{|(((({{..{||||,,.,|))}|,{.....,}}}.}}}}...,(((((...((((....{{((...{{.,........}}}...))}})))).)))}},||.}}}))||(((..((((..((((((({.....(((.(((.((((((((((((,,.,.,{..||.|||,,|{,(((({(((((({,..,,..}}}}))))...}}},,|}..}}}.}}}})||||{||{,,.{,...,,,((((.....|}}},}},}})})))}))}},,})))))))))))))).)))(((((...................))))).))))))))..))))..))))).}.)))))))))((((((((((((((((({{{(((((.(((((,...,.,.{{|,.(((({{....}}}})))..,,,.{{{....)))......,}))).))))).....,})}........)))))))))))..))))))......(((((((..........(((((.(.,(({....)))...)))))(((({....})))).{((({..(,.....(((.(((((....)))))..)))......}.,)))))))))))))))))))).))))).,,...............))).)))))))..)))))))..)).)}}...{(,.((((.....))))..}),,.(((((....)))))...((((((..(((((...(((((((..((((((...(((,{(((((.(((((((((((((..(((.(((.....))))))..))))))))...,.)))))..,,}))))))))..........))))))..)))))))..)))))..)))))).(((((.((((((.....(((((.....))))).,...)))))).))))).,))))).)}||||||,,{((((..({.((((((((.....,,.(((((.........)))))......{(...(((((...,,.....,..)))))...}}...((((((((.{{.....}}.))))))))((((......(((({((.((((......)))).)).))))).....)))).((((({...)))))))))))))),)}))))|,{{{||...{{{||||,,.,,))}}}},.{{{{|{{{.......,,,,,,))}}}}})...

Transcripts

ID Sequence Length GC content
GCGAAGGACAUUUGGGCUGUGUGUGCGACGCGGGUCGGAGGGGCAGUCG… 2013 nt 0.5524
Summary

The protein encoded by this gene is a phosphatase with dual specificity for tyrosine and threonine. The encoded protein can dephosphorylate MAP kinase MAPK1/ERK2, which results in its involvement in several cellular processes. This protein appears to play an important role in the human cellular response to environmental stress as well as in the negative regulation of cellular proliferation. Finally, the encoded protein can make some solid tumors resistant to both chemotherapy and radiotherapy, making it a target for cancer therapy. [provided by RefSeq, Aug 2017]

Forensic Context

A study in human dermal injuries demonstrated that the DUSP1 mRNA showed an initial decrease in expression during early healing stages followed by an increase, peaking at 3 days, and was detected at all sampled time points from 0–2 minutes to 6 days post-injury [Palagummi et al. DOI:10.1007/S00414-013-0941-5]. In a separate human study on acute myocardial infarction, the DUSP1 was validated as a differentially expressed gene significantly up-regulated in patients who developed heart failure, with RT-qPCR analysis showing it provided good predictive accuracy (AUC 0.847) for distinguishing this outcome [Liu et al. DOI:10.1042/BSR20222552].