Basic Information

Symbol
DUSP3
RNA class
mRNA
Alias
Dual Specificity Phosphatase 3 VHR Dual Specificity Protein Phosphatase VHR Vaccinia Virus Phosphatase VH1-Related Dual Specificity Protein Phosphatase 3 Vaccinia H1-Related Phosphatase Serine/Threonine Specific Protein Phosphatase EC 3.1.3.16 EC 3.1.3.48
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004090.4
Sequence length
4095.0 nt
GC content
0.4972

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1405.80 kcal/mol
Thermodynamic ensemble
Free energy: -1479.40 kcal/mol
Frequency: 0.0000
Diversity: 1123.13
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((((.((((((((((((((.(((.((((((((...(((((.(((..(((((((((....)))))).(((.(((((.((.....))))))).).)))))))).))))).(((.(........))))..))))))))....((((((((((((......)))))).......(((((((((..((.....))..)))))))))...((((.(((.((...((((((..((((.(((((((((.((((((((((((((((........(((((((..((((((((((...((((((((.....((((((((..(((((..........((((((......((((.(((.......))).))))..)))))).(((((((.....))).)))).....))))).))))))))....(((((.((.((((.(((((.((........))..))))).)))).))(((((((((((((((.(((....)))...))))))....))))))))))))))....((((((((((((........))).(((((((..((.((((.((......)).)))))).))).))))((((((((......((((.(((.(((((((.((((((.....))))))..)))))))..))).))))...((((((((((((..(((......((((((((((.((((((.((((((((((.((...(.(((((((....))))))).)............(((((((....((((((...))))))((((((((((((((..(.(((((((((((....))))))))..))).)..)))))).....))))).))).....(((......))))))))))..((((((((.((..(((((..((((((((..(((.(((......)).).)))..)))))))).)))))..)).........((((((......)))))))))))))).((((..((......))..))))..(((((((((.((..((((.(((.....)))...........((((((.(((................))).))))))(((((..(((((...........)))))....)))))....)))).)).))))))))))).))))))((((((((.((((((...........)))))).)))))))))))).)).))))..))..)).))))))..((((.....))))...........))))))).))))..))))((((....))))....((((.(((...((((.....))))))).))))..((..((((.(((...)))..)))).))...)))))))).)))))))))........((((........)))).))))))))((((((..(((((((...((((((.....)))))).)))))))....))))))........(((((((......(((........)))))))))))))))....))))).)))))))....((.(((((.((((((((((.((((((((((.((........)).)).))))))))....)))))))........))).))).)).)))))))))))))))))).)))).)))))...))))((((((.((...((.((((.........))))..))...((((.(((.....)))))))(((.....)))))))))))..))))))))))).))))..))))))..))).)))))....))).)).))))(((.((((....)))).)))....))))).)))))........((((.((.((((((((((......((((((((((........)))))..(((((((..((((.(((((....))))).))..(((((.((((((((.............((((((((((((....(((..................(((((((.(((............))).)))))))..((((...((((.(((((((((((((((((.((((((((.......))))).)))......(((((((((.((....)))))))))))..............))))))(.((((((.((((((...)))))))))))).)(((((((...((((((((..(((((((....))))).))..))))))))((((((((...(((((((((.((...)).)))).))))).....)).))))))......)))))))((((((......((((.((.(((((.(((.(((..(((((..((((..((((.(((....((((((.(((((((((((.((((.(((.....))).))))...(((((((.(((.(((((......))))....).))).))))))).((.((.....)).)))))..)))))))).)).)))))))))))..))))((.(((.((..........)).))).))....(((((............)))))...))))).)))))).)))))..)).))))...)))))).((((((((...((((((((((.(((((((....(((((((((((((((........(((((.....))))).......))))))..(((((((....)))))))....)))))))))...)))))))..(((((...))))).((((((((((((((...))))))))))))))....(((((..((((((((((...(.(((((...........((..(((((((....)))))))..))(((((.....)))))....((((((..........(((......)))..(((..((((...(((.....)))))))..))).....)))))).......))))).))))).)))))).)))))((((((((.....))))))))..))))..)))))))))))))).)))))(((...)))(((((((((((.....)))))).....)))))..(((.(((((((....((.(((.......))).))))))))))))....))))))))))....)))).....((((..(.((((((.((((((....((........)))))))).))..((((((((....((.((((....)))).)).....).)))))))....)))).)..)))))))....)))))))))))).)))))))))))))....((((((..(((((.(((((((.((((((((.(((.(.(((((..((((.(((((((((((....))))).)))))))))))))))).)))..((((((((.....((((.(......).)))).......)))))))).(((((((((..(((((((((((((...(((...........)))..)))))..........(((((((((((.....((((((((..(((.(((((((.(((.(((....((((((..(((((.......((........)).(((((......((((.(((((((.(((.((......)).))).)))))))))))....)))))..)))))))))))....))).))).(((((((.(.....).))))))).....(((((((.......)))))))..((((...))))))))))))))))))))))...))))(((((.....))))).....)))))))))).))))))))))))))..................((.((((((...)))))))))).))))))..))))))).)))))..)))).))))..)))))))(((......)))((((((((.......))))))))......))))))))).)))))).)).)))).(((..(((((((((..(((((((((((.((((...((((.(((((..(((((.(((((............((((((.......)))))).....((((((.....)))))).)).))).)))))..))))).))))...)))))))))))........(((((((..((...(((.((.(((......))).)).)))..))))))))))))).....)))))))))..))).....
Thermodynamic Ensemble Prediction
...(((((((((({((((((({{(((((,(({{{(({((((...(((((.(((..(((((((((....)))))).(((.(((((.((.....))))))).},)))))))).))))).|||.|.}},....),)}.,)))))))),)||||{{{{((((((......))))))....,..(((((((((..((.....))..)))))))))..,,{{{,{{{.{{|,,((((((..((((.(((((((((.((((((((((((((({........(((((((..((((((((((...((((((((....((((((.(((((((.,,,..,.....|,.|||..{((((((({,,.....{({.{((((((((||||||.{{{{(((,.{,{|||.}},},,}..}||||{{{|||,,{,,|,|,{|||({{,(((..,.||}((||||,,..|,.,|||||,|,{{.(((((((((((((((((.(((....)))...))))))....))))))))))).))..,{{,|,,,,}))|,....}},}))}|(((((((..((.((((.((......)).)))))).))),,))){(({{{||,,...,(({(,(((.(((((((.((((((.....))))))..)))))))..))),||||..,{(((({(({(,(({(...((({..((,.{(({{{((({.,,((((..,}))}..,,,({{{,|||)}.}})}}))))}},}.}))))}}},|}))),}}}}}||||||...})))))||,{{(({((((((..(.(((((((((((....))))))))..))).)..)))))).....))))).})}|...,|||.,,,.})}||||,{{{,{((((((((.((,,(((((,,((((((((...,,{({..,,,,.)|,)})}}}.}}}}||||.}|||}..}}..|......((((((......))))))}}}}}}}|.{(((..({......})..))))|,||||{{{{{,||,})}}),||{.,,..,}}.,,,,,||,..{|||((.{{{...,........,,,,)}),))))))||||..,,})))}}}}}}.|.,,}})})}...))))))))).))),)}.,))))))||}..,}))))((((((((.((((((,.,....,.}.)))))).)))))))).((((((((.,.{(((..,|..,,|,.,,(({{.....))}},,,..)))),.)))))))){(|....)),((((....))))....((((.(((.,,({((....,,)))))).)))).)))))))))))))........,..,.(({,...})))....,,||{,.{(((({...,.......})))))})})))))))){(((((..(((((((...((((((.....)))))).)))))))....))))))........(((((((......(({........}}}))))))))))))....))))).)))))))...,((.(((((.((((((((((.((((((((((.((........)).))},))))))).,..)))))))........))).))).)).)))))))))))))))))).)))).)))))...)))){{|||,,{,...((.((({..,......))))..))...,,,(((((.....)))))||(((,,,,,|||||||||}|{,|||}}}|||||{|,},..}}}||||.|||,}}|}}....)}}.},,)))}}||,{{{{....))))}))...,}))))},)))))........{{{,.{{.{{{{{{{{{{.,,..,((((((((((........))))},,(((({{(..,,...,{|{{,...}}}}|,||..(((((.((((((({.,{{.......},|(((((((((((....((({.....{{{,,,,.,,,.(((((({.(((.,........,.})),})))))},|{(((...(((,,(({(({{((({((((((.((((((((.......))))).)))......((((((((((((....)))))))))))..............)))))),.{(((((.((((((...)))))))))))}.|(((({{{...((((((((..(((((((....)))))},)..)))))))),,,((({{,,{{,,{,{{{{.{{|,,})|))|}.}},},.,...}},))))}|......,}}}}}|((((({......||||.,{,{{(((,{({,(((,,(((((..((((..((((.(((....((((((.(((((((((((.((((.(((.....))).)))),{.(((((((.(((.(((((......)))}.,.,).))).))))))).||.{,....,}).)}}},..)))))))).)).)))))))))))..)))){{.{{{.((,,,.......}),))).)),,,,|||{{..,.......,,)})}}..,}})}},))}})}|},}}}..,}})))},,,||}}||.((((((((...((((((((((.(((((((....(((((((((((((({........(((((.....))))).......)))))},.(((((((....)))))))....)))))))))...))))))),.(((((...))))).{(((((((((((((...)))))))))))))}...,(((((..((((((((((....(((((({{.........{{..(((((((....)))))))..}}(((((,...,))))).{{...||||........}})))))){{.||{{{(((..((({..,(((.....)))))))..||}.....,,}}}),,..,}}))),)}.)))).)))))).))))){(((((((.....))))))))..))))..)))))))))))))),||}}|{{|...))}{|||{((((((.....)))))},{{{{|||||,.(((.((((({,..{{((.(((.,....}))).))))))))))))....,}}}}}}}}}....)))}}.,}||||},.|,||||||.,{{|||,,,,{{..,.....)))))))}.}}.,|||{{{{|,,,,{|.{|||.....}||{||,....}.})))))}.,..}}})}),.}}}))))....))))))))))),.})))))))))))).,,,||{{{,..{||||,|{|||||,||||||||.||{,|.(((((..((((.(((((((((((....)))))},))))))))))))))..)))..((((((((...,.,(((.{......},),},.....,.)))))))).{((((((((..(({(((({({{{{...(((,.....{{.{,|||,.,}}||,|}}}..,,},,|,{{{{{{{,,...((((((((.,(((.(((((({.(((.(((....((((((..(((((.......,,........,}.(((((....,.((({,(((((((.(((.({......)).})).)))))))))))....)))))..}))))))))))....))).))).(((((((.{.....}.)))))))..,,.(((((((.,....,))))))),|((((...)))))))))))))}))))))))...||}||||||,,...})))),,..,,...,.}))),)))))))))))))}..................{(.((((({...}))))))},}.)|||||,,}}|||||,||||},,||||{|,,,..}||||}|(((......))){(((((((.......)))))))).......|||||||},,||}}),)),}}||{(((..,,,,{||||}}|((((((((((((((...{((((.,,,||}}|,|}}}}|,,}}}}}}}}.,,.,{,,.,,.,,}}}}}}}}}},,,.,||||||}.,,,))))))})}.,}}})))))||)))),.,,,,...}}}}}|||||||,...,,}|||{{{{..|{|..(((.{,.(((......))).},.))),,,,}}}}}}},,,,.....,||||}}},,}}}}.....

Transcripts

ID Sequence Length GC content
GCCGCUCUCCGCCUCGCUUGCUCCUGCCGGGCGUGCAGGGCCCCGCCGC… 4095 nt 0.4972
Summary

The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene maps in a region that contains the BRCA1 locus which confers susceptibility to breast and ovarian cancer. Although DUSP3 is expressed in both breast and ovarian tissues, mutation screening in breast cancer pedigrees and in sporadic tumors was negative, leading to the conclusion that this gene is not BRCA1. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the DUSP3 was downregulated in subcutaneous adipose tissue during short-term weight loss in obese participants [Bollepalli et al. DOI:10.1038/ijo.2017.245]. A study in male BALB/c mice demonstrated that sub-chronic dietary methylmercury exposure significantly altered hippocampal protein and RNA expression, with high-dose exposure downregulating the DUSP3 at both the protein and RNA levels, indicating its role in the downregulation of MAP kinases and subsequent effects on cellular proliferation and differentiation [Mellingen et al. DOI:10.1093/Mtomcs/Mfab022].