Basic Information

Symbol
DUSP5
RNA class
mRNA
Alias
Dual Specificity Phosphatase 5 HVH3 Dual Specificity Protein Phosphatase HVH3 Dual Specificity Protein Phosphatase 5 Serine/Threonine Specific Protein Phosphatase VH1-Like Phosphatase 3 EC 3.1.3.16 EC 3.1.3.48 DUSP VH3
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_004419.4
Sequence length
2477.0 nt
GC content
0.5579

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-967.80 kcal/mol
Thermodynamic ensemble
Free energy: -1009.94 kcal/mol
Frequency: 0.0000
Diversity: 564.51
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((....((((((((((.((((((((((((..((((((((.((((((((...(((((.((((((..(((((.(((((.....)).)))..))))))))))).)))))..)))))).((((((((.(((((((((...(((((((((.((....)))))))).)))...)))).)))))...))))))))(((((((.(((....))))))))))..........))))))))))(((((((((((.((((.....(((((((......)))).))))))).)).)))))))))...)))))))).....))))))))))))))...(((((.(((...))).).))))............(((((((((((((((((((((((..(((((((((((((.((((.....)).)))))))(((((((((((((((((.(((((((((....((((((....)))))).((((((((((((((.......)))).))))))).))).....))))...)))))..)).))))))))))).))))........)).)))..)))..))))..)))))))((((((...(((((....)))))....))))))..(((((((......)))))))..(((.(((.(.(((((.....((((((((((...(((((((((.(.((((.....((((((.((((((...(((...)))...((((..((((((((((...........((((.((.(((..(((....)))..........(((((((.((.((.....((((.....(.(((((...))))))....)))).....((((...))))...(((....))))))).))))))).))).)).))))..............)))...)))))))..)))).)))))))))))).....)))))))))))))).((((((((((......((((...))))((.(..((((((((..((...(((.(...((.((((.(((((((((..((((.........((((.((((((........))).))).))))....((((.....))))((((..............))))((((((.((((((.(((.......))).....)))))))))))).......))))..))))))))).)))))).).)))...))..))))))))..).)).((((.((((((((((............((((((((((((........((((((((...(((((((((((..(((....((((.(((((((((((....))))))).......((((.(((((..(((.((((..((((.((((((((((.(((((((((.(((((.((((((.((((..((.(((((...(((((..(((((((.((((.(((((....))))).))))(((...(((((.....(((((..(((..((((.(.(.(((((.(((((...))))).))))).).).))))..)))..))))).))))).)))((((((((...((((((((.(((.((((.........(((...)))..(((((.((..((((....)))).)).))))).)))))))..)))))))).(((((((((((...............(((((((((((((((.......((.....))........(((((((((((.............)))))))...)))).))))))))....(((((.....)))))......(((((.....)))))............)))))))))))))))))).))))))))..))))))).)))))....))))))).))))))))))(((.......)))(((((.((((.(((((....((((((....))))))....))))))))).))))).....((((....))))(((((......)))))......))))).)))).)))))..............))))))))))..)))).)))).)))))))))))).((((((...)))))).((.(((.((..((....(((((((.(((..(((.(((((((((....)))..))))))))).))).....(((.......)))........)))))))....))..))))).))))))...))))....)))))))))))))).))))).)))..)))))).)))))))))..))))))).))))))))).)))))...)))))))))).....)))))).))).))).((((((((((..(........)..))))))))))..(((((.....)))))))))))))))))........((((((.((((..((......)).)))).))))))((((((((.......((((.(((....(((........)))......))).))))...))))))))......(((((((........))))))).)))....
Thermodynamic Ensemble Prediction
.,,,,,..((((((((((.((((((((((((..((((((({,((((((((...(((((.((((((..(((((.(((((.....)).)))..))))))))))).)))))..)))))),((((((((.(((((((((...(((((((((.((....)))))))).)))...)))))))}))...))))))))(((((({{(((....)))))))))).,,,...,},})))))))))(((((((((((.((((....,((((({{..,,,.)))}.})))))).)).)))))))))...)))))))).....)))))))))))))).},{((((.(((...))).),}))}((((..((((.,((((((((((({(((((((((((..(((((((,(((((,((((...,,)).)))))))(((((((((((((((((.((((({({(...,(((((({{..}))))).|||(((((((((((.......)))},))))))),}}}.....))))...}))))..)),})))))))))).))))........,,.)))..)))..))))..))))))){(((((...(((((....)))))....)))))}..(((((((......)))))))..(((.(((.(.(((((.....((((((((((...(((((((((.(.((((.....((((((.((((((...,,,.,,|||...,.((((((...(((((.(({......})).))))).)))))}.........(((((........))))),{,.,,,,,|{{{,....{.(((((...))))),....}}}|,,...((((...))))..||{{,.,{|,{((.{,{,,,})),}}},),,},||..............)))...,}}}})).,)))).)))))))))))).....)))))))))))))),((((,,,,|.}}}}..,(((,,,|,||((,,..((((((((..((...{((,,...((,((((.,((((((((..((((.........((((.((((((.......,))).))).))))....{(((...,,))))||||{,,....,,..,..,}|,((((((.((((((.({(,,....,))).....)))))))))))).).....))))..))))))))).)))))),).)}},,,))..)))))))),,),}}.{(((.((((({(.((,.,..,,,{{{.((({{(({((((,.......((((((,,...||||||{{,,,,,|||....{|||,{{||||||,,||}.,,),)))),.}}}..,,,|,||||,.,((({{({(,(((((,(({(((((((.(((((((((.(((((.(((({((((((..(,{(((((...(((((..(((((((,((((.(((((....))))).))))||{...{{{{{.....(((((..(((..((((.(.,.(((((.(((((...))))).))))).}.}.))))..)))..))))).}})}}..,,((((((((...((((((((.,,,.(((,{{{,{{...(((...)))..{((((.{(,,(({{..,,)))}.),.)))))})))))),}})))))))).{((((((((({..,,..........,(((((((((((((((.......((.....))........(((((((((((.............)))))))...)))).))))))))....{((((.....))))}...,..(((({.....}))))............)))))))))))))))))).))))))))..))))))).)))))....))))))).))))))))))(((.......)))(((((.((((.{((((....((((((....)))))).,..))))))))).))))}.....{(((....)))){((((.,....))))),.....))))).)))),,))))..............)))))))))),.}},|,||||{||.|||}||||{{(,(((({,,.,||,,.((.(((.((,.((....(((((((.,,{..(((.(((((((((....)))..)))))),))},)}.....(((.......)))........)))))))....)).,)}))).))},})}.,)))),.,.)))))))}}))),)})))))})||{{}|||},,|||,,,,,)}})}))))),)}))))))).,))))...)))))))))).....)))))},))).))).((((((((((..(........)..))))))))))..{((((....|))))}}}}}}}}})))}.....,.(((((((.((((..((......)).)))).))))))}.,,..,,,,,,,...||}|||,.,,}}}}},}}},,,,|||||...))))))))),,))))}}||,.{(((((({{{,.....,}})))),))})}.....

Transcripts

ID Sequence Length GC content
GGCUUCUAGGGCGGCGAGCGGCCGGGCUGGCUAUCGAGCGAGCGGGGCG… 2477 nt 0.5579
Summary

The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, is expressed in a variety of tissues with the highest levels in pancreas and brain, and is localized in the nucleus. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that single-cell RNA sequencing of peripheral blood mononuclear cells from an irradiated patient revealed significant alterations in cell type proportions and gene expression profiles compared to healthy controls [Yan et al. DOI:10.3892/etm.2025.12846]. A study in humans demonstrated that the DUSP5 is a marker associated with mechanical asphyxia and was used in a molecular prediction model for cause-of-death analysis [Song et al. DOI:10.1007/s00414-023-03091-1].