| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCUUCUAGGGCGGCGAGCGGCCGGGCUGGCUAUCGAGCGAGCGGGGCG… | 2477 nt | 0.5579 |
The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, is expressed in a variety of tissues with the highest levels in pancreas and brain, and is localized in the nucleus. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that single-cell RNA sequencing of peripheral blood mononuclear cells from an irradiated patient revealed significant alterations in cell type proportions and gene expression profiles compared to healthy controls [Yan et al. DOI:10.3892/etm.2025.12846]. A study in humans demonstrated that the DUSP5 is a marker associated with mechanical asphyxia and was used in a molecular prediction model for cause-of-death analysis [Song et al. DOI:10.1007/s00414-023-03091-1].