Basic Information

Symbol
DUSP8
RNA class
mRNA
Alias
Dual Specificity Phosphatase 8 C11orf81 HVH-5 HB5 Serine/Threonine Specific Protein Phosphatase Dual Specificity Protein Phosphatase HVH-5 H1 Phosphatase, Vaccinia Virus Homolog Dual Specificity Protein Phosphatase 8 FLJ42958 Chromosome 11 Open Reading Frame 81 EC 3.1.3.16 EC 3.1.3.48 HVH8 VH5
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_004420.3
Sequence length
4824.0 nt
GC content
0.6629

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2255.90 kcal/mol
Thermodynamic ensemble
Free energy: -2330.39 kcal/mol
Frequency: 0.0000
Diversity: 1197.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.(((((.((((((((.(((.((.(((((.......)).)))..))))).)))))..))).)).)))))))..((.((....)).))..(((((((((......)))))(((..(((((((((((((((((((((..(((((((((..(((.(((....))).))).))).))))))))))))))((((....))))..)))))).)))))))..))).(((.((((.(((.(((.(((((...((((((....(((.(((((..(((((((((((((((.....)))))).......))))))))).))))).)))..))))))))).)).))).)))...)))).))).(((..((((..(.((((.(((((((...))))).)).).))))..))))...)))......((((((..((((((((((((.........)))))).....((((((((..................)))))))).(((...)))..(((((((.(((..((((......))))....(((..((((((.(((((((((((((..((((((((.(((.(((((((((..((((((((((..........))))))).(((((((.....((((((((.((..((((......))))))..))))))))((((((...)).))))..((((..((((.(.(((((....))))).).)))))))))))))))))))))).))))).))).))))))))(((((((((....)).)))))))((((((((.((((((.(((..((...))..))).))))))((.((((((.........)))))).))((((.(((((((((.((.((((((((((((((((((.((((((...((.((((((.......))))))))..(((.((.((((((((((.....((..(((.(((((....(.(((((((((.........(((((.(((((.(((((((((((.....((((((((.....)))...(((.((((.....(((......))))))).)))...((((...(((((((((.(((((((((((((.(((.((((((.((.....))((((...........(((.....)))...........))))((((((((....)))(((((.....)))))..))))).))))))))).))..)))))......(((((((((..............(((.(((.((.((.....(((((.((((((((((.(((..(.(.((((((((.((((.(((....)))))))(((((((((((((((.((((((..((((..(((.((((((((((..(((((((.((.((..(((((((((.....))))).((.(((((....))))).)).(((...)))(((.(((..(((((..((((.(.(((((((((((((((((((......(((...((((((.((......(((...)))(((((((.((((...(((.((((((.((((((((((((...((((((((((((.((.....)).))))...((((...)))).((.((........)).)))))))))))))).)).)))))).((((.(((((((((((........(((.....)))............((((.....))))((....)).))).)))))))).)))).((.(((((((((((((.((((((((.(((.....((((.....)))).....)))))))))))((.(((((((((.(((((..((...))..))))))))))).))).))(((.((((.((((..(((((...((((((((..........))))))))..((((((.(((((((..((((....((((((((((....((((((((((((((.((..((.((.(((((..((((....)))).....((.((((((((..(((((..((((((....))))))..))))))))))))).)))))))..)).)).)).))).)).))))).))))))))))..((.((....)).))))))))))...))))))).)))))).)))))..)))))))).))))))).))))...))))).)).)))))).)))....)))).))))))))).))))))...)))...)))))))..)).))))...)))))).).))))..)))))))).))).....))))..)).)))))))))))))..)))))).)))..))))..)))))).))))))(((.((((((.((.((((((((((.((......)))))).)).....((((((((.((.(((((..((....)).)))))))..)))))))).)))))))))))).)))(((((.((((((((((.(((.....))).)))))))........)))...)))))......((((....(((((((........))))))).....)))).......)))))).))).(((((((....((((.....(((((..(((((((((((...........((((.(((((......(((((....))))).....))))).))))..........((.(((((.((((((...((((((((................))))))))......(((........)))..))).))).))))).))..((((((((........)))))))).....((((((........))))))........(((.((((((........(((((((...((((((.((((..((((((.(((.((((.((.((.((..(((....)))..))...)))).)))).))))))))))))).))).)))....)))))))))))))))).........)))))..(.((((((...)))))).)...))))))..))))))))))))))))((((((.....))))))....))))))))).)..))).))))))))))...)))))....))))))).)))...))).)))))).......)))))).)))))))))...)))).))))).......))).)))))))))))))...)))))))))).)))).)...(((((((.((.((((.(....((((..((((((((......))))))))...((((((....)))))).((((((.(((((...(((((((.....(((((...)))))))).)))).....))))).))))))..))))..).)))).)).))))))))))))..)))..))(((((((((((((((((((((((...((((((.(((...((((((.((.(((((((((....(((((.((...(((((((((((.((.((((((..((((.(((.....(((..(((((.....))))).)))....)))))))))))))....((((((((...))))))))((((((.(((..(((....))).)))))))))...)).))).))))))))...))...((((.((..(((((......)))))..)).))))........((((((((((.(((((((((..(((((((..........(((((........)))))...))))))).((.(((......))).)).......)))))))))))))....))))))..)))))))))))))).)).)))))).....))))))..)))...))))))).........(((((...)))))))))))))))).))))))))).)))))))))))....)))))).))))))((((((((((((((...)))))..))))))).))((((..((((.((.(((((.((.((((((((((((.((.......)).))..........................((((....))))...(((((.((((......(((........)))...............(((.(((((((((((.....(((((...((((.((....(((((....))))).(((((....(((((......((((((....((((((........))))))...))))))..)))))))))).)).))))...)))))......)))))....)))))).)))((((((((.((......((.....))........)).)))).)))))))))))))))).)))))))....)).)))))))))))..)))).(((((((...(((((.......))))).....)))))))((((.......)))).((((((.............))))))(((.((((......)))).)))..(((((((((((...(((((....((((...(((((((((.((((((((.((((((((((((((((((((....)).)))))..........)))))).(((....))).............((((..........))))...))))))).)))))))).)))))))))((((((......))))))(((((......(((.((....)).)))......))))).......(((...(((((((.(((....))).))...)))))..)))))))...)))))..))))).))))))....(((((.....)))))))))))))))))))))).)))))).))))..((((((((....))))))))))).))))).....)))))))..)).)))).))))))..)))))))))))))))))))))))))((((..........))))((((....)))).............))))........
Thermodynamic Ensemble Prediction
.((((.(((((.((((((((.(((.((.((({{.......)}.)))..))))).))))}..))).)).))))))),,,(.(((((.((({(.((((((((((....,.|||||(((({(((((((((((((((((((((.{(((((((((..(((.(((....))).))).))))))))),)))))))}((((....)))).,)))))).))))))},,))).}}))|||,.||||{.||,|||{||{((({{{....(((.(({({..{((((((((((((((.....)))))).......))))))))).))))).)))..),))))))).)))))...))).}|{{{.....})}}.((((..(.((((.(((((((...))))).)).).)))}..)))).,{|}}...,,,((((((..((((({((((((.........)))))}.....((((((((...{{{.{.......}}))))))))).{({...))).|(((((((.(((..((((......))))....(((..((((((.(((((((((((((..((((((((.(((.(((((((((..((((((((((..........))))))).(((((((.....{(((((((.,{..((((......))))})..)))))))}(((({{...}).))))..((({..((((.(,(((((....))))).),)))))))))))))))))))))).))))).))).))))))))(((((((((....)).)))))))((((((((.((((((.(((..(,...,)..))).))))))((.((((((.......}.)))))).))((((.{((((((((.(,{((((((((((((((((((.((((((...((.((((((.,....,))))))})..(((.((.((((((((((.....((..(((.(((((..,.(.(((((((((.........(((((.(((((.((((((((.((,...,((((((((.....)))},.{{{.{{{(.....,{,......},,)))),)),...((((.,,(((((((((.((((((.....,..,((.(.((.((((.....)))).)).,,.......{{,.,,(((((......,,,(,(((({{{(((((,,..|}}(((((.....)))))...{{{,,(({{,,{||{(((({((((({.(,({,..((((((((((({......,,..}))},.....|,....{{{,...,{,{{.,}},,,))))).((((((.{.((((.(((....)))))))).)))))).((((((.((((((..((((..(((.(((((((({({.(((((((.((.((..(((((((((.....))))).((.(((((....))))).)).(((...)))(((.(((..(((((..((((.(.(((((((((((((((((((...,..(((...((((((.((......(((...)))(((((((.((((...(((.((((((.((((((((((((...((((((((((((.((.....}}})}))},.((((...)))).((.(({{...,,.)).)))))))))))))).)).))))}),((((.(((((((((((........(((.....))).,,,........|||{.....}}}}{{....}}.))).)))))))).)))).((.(((((((((((((.((((((((.(((.{{..((((.....))))}}...)))))))))))((.(((((((({,(((((..((...))..))))))))))).))).))(((.((((.((((..{((((...((((({((,..,,,,.,,|||||}||.,((({((,((((({{..((({...{((,,((((((....((((((((((((((.((..({.((.(((((..((((....)))).....((.((((((((..(((((..((((((....))))))..))))))))))))).)))))))..)).)).)).))).))}}))))}}}))))))))..)}},,....)}.,.))))))))...))))))},)))))).))))}..)))))))).))))))).)))}..}))))).)).)))))).)))....)))).))))))))).))))))...))).}.)))))))..)).))))...)))))).).))))..)))))))).))).....))))..)).)))))))))))}}..)))))).)))..))))..)))))).))))))(((.((((((,((|(((|((({||.,|,,,..,)))))||)),.}}}((((((((.((.(((((..((....}).)))))))..)))))))).|||||||))))).))),}}||))).(((((((.(((.....))).)))))))...,,,..{{{,(({{{{||,,,}.{{,{....(((((((........))))))).....},,,....}}}|||}}|,|||||||,|||}}}}|||,.,,.((,((((((.(((((.(({.......{{{{....}}}}........(((((....)))))..})}....))))))))))).}}.,,{,,{||||(({(({.,,((((((((................))))))))......{((........))},{|||{,,,.))))),.},,((((((((........)))))))).....((((((........))))))..,.....(((.((((((........(((((((...((((((.(({{{{(((((({(((.{(({.{(.,,.{({,,,,|||,.,},.,)...))),.)))).))))))))))))).))).)))....)))))))))))))))),,,,......,((((.{{(((((,...}))))),)..))))|||{||,.|,,||{{{,|{{{{,{,.,{((((((((......)))))))))))},)))))..},,)))))),)))))}}))).))))),)}}.......))))))})))).,)))))).))))))))),},)))).||}||....},.)))))))))))))))))...)))))))))).)))).,..{(((((((.((.((((.{.,.{((({..((((((({......})))))))...((((((....)))))).(((((({{,(((...(((((((....,({({|...)))))))).)))}.....)))))}))))})..))))}}..)))).)).))))))))))))..)))..))(((((((((((((((((((((((..,{(((((.,.,}}}||{,{(.(({((((((((,..,.(({{,,{(...||||{||||{|}||,||||||,||(((.(({....||||..{{{{(|...,))))).}||,...|||||||||||||{...(((((((({,.||||||||((((((.(((..(((....))).)))))))))}..,,}))).))))))))},,}}}..{(((.((..(((((......)))))..)).)))).....}}}||{{(((((.{{((((((((.{(((((((..........(((((........))))).)))))),)).||}|||...,,,|||{||,......,}}))}}},})))},}}))})))}})))))))}))})))}))},,,.,,.(({.(((((.{((((((..(((.....)))..))))))}))))))))))))))))))).))))))))),})))))))}))}...)))))).)))))}((((((((((((((...))))),.})))))).))((((..((((,((.(((((.((.(((((((((({,.({.......||{{{..........................,|||},..,}}}...(((((.((((......{{({{..,,..,}}.....,.........{{(.(((((((((((.....((({{..,(((({((....|||,|,,,,{{{{{,(((((....(((((...,,.((((((.{{.({((((........)))))).},))))))..)))))))))).)..,)))}}.}))))......)))))....)))))).))}((({(({{.((,.....({.....))........},.)))),)}}})))))))))))).)))))))....)).)))))}))}}}..)))).((((((({.,(((((.......)))))..,..)))))))((((.....,,||||.{(((((.............))))))(((,(({(..,...)))},))),,|{(((((((((...(((((..{.,{((,..,,(((((((.((((((((.((((((((((((({(({{{(....||,|}}},,},,,.}.,,)))))).(((....}},...,.,.,.....((((..........))))...))))))).)))))))).)))))))||(((((({{....,},|{|({,,.,)))}.|.....)))))).))))......,|||.......|||,..{((({{{.{((,...)}}.)),..)))))..)})})),...)))))..))))).))))}}....(((((|...,)))))))))))))))))))))),)))))).))))..{(((((((....)))))))}))),})))).....)))))))..)).)))).))))))..))))))))))))))))))))))))),((({{{{{..{{{|,,|(((,....}))}..}}}}...)}}}).))}.......

Transcripts

ID Sequence Length GC content
ACUCGCGGCCGAGCGCGGCGGCCGAGCCGGCUCCCCCCACGACGCCCCG… 4824 nt 0.6629
Summary

The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates SAPK/JNK and p38, is expressed predominantly in the adult brain, heart, and skeletal muscle, is localized in the cytoplasm, and is induced by nerve growth factor and insulin. An intronless pseudogene for DUSP8 is present on chromosome 10q11.2. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic methamphetamine administration significantly downregulated the DUSP8 in oligodendrocytes within cortical brain regions, as identified through single-cell RNA sequencing analysis [Oladapo et al. DOI:10.3390/Ijms26020649].