| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUGUUUGGCGAGGCGGCCGCGCCGGGGCGGAUCGUGCGGCCGGCGGCUC… | 14493 nt | 0.4659 | |
| CUGUUUGGCGAGGCGGCCGCGCCGGGGCGGAUCGUGCGGCCGGCGGCUC… | 14595 nt | 0.4664 |
This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, and contains a PAZ domain and a PIWI domain. It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
A study in mice demonstrated that the AGO2 is degraded by miR-671 via AGO2, and its knockout leads to decreased miR-7, increased miR-671, elevated levels of miR-7 targets, and excitatory/behavioral phenotypes [Patop et al. DOI:10.15252/embj.2018100836]. In the context of miRNA function, AGO2 uniquely mediates cleavage of extensively paired targets and is a central component of the RNA-induced silencing complex (RISC) [Shang et al. DOI:10.1038/s41576-023-00611-y]. A study in mice demonstrated that the AGO2 mRNA was up-regulated 2.63-fold in bone marrow cells 6 hours after a 6.5 Gy whole-body ionizing radiation exposure, as identified through microarray analysis [Dai et al. DOI:10.1080/09553000600857389].