| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUGCGGUGGGCUAGCGGACGGUCCGGCUUCCGGCGGCCGUUUCUGU… | 19940 nt | 0.5214 |
Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
No relevant information is available at the moment.